LIMD2-LIM domain containing 2 Gene View larger

LIMD2-LIM domain containing 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LIMD2-LIM domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LIMD2-LIM domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004400
Product type: DNA & cDNA
Ncbi symbol: LIMD2
Origin species: Human
Product name: LIMD2-LIM domain containing 2 Gene
Size: 2ug
Accessions: BC004400
Gene id: 80774
Gene description: LIM domain containing 2
Synonyms: LIM domain-containing protein 2; testicular tissue protein Li 106; LIM domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccaggctgcaggagccgcccaggccaccccctctcatgacgccaaaggcggcggcagcagcacggtgcagcgctccaagtccttcagcctgcgggcccaggtgaaggagacctgcgccgcctgccagaagaccgtgtaccccatggagcggctggtggccgacaagctcattttccacaactcttgcttctgctgcaagcactgtcacaccaagctcagcctgggcagctacgccgcgctgcacggggagttctactgcaaaccccacttccagcagctgtttaagagcaaaggcaactacgacgaggggtttggccgcaagcagcacaaggagctctgggcccacaaggaggtggaccccggcaccaagacggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sterol carrier protein 2
- prolactin-induced protein
- ribosomal protein L27a
- gastrin-releasing peptide

Buy LIMD2-LIM domain containing 2 Gene now

Add to cart