Cart 3 Product Products 340,20 € (empty)
-
1 x LOC440461-...113,40 € -
1 x C20orf24-c...113,40 € -
1 x HBD-hemogl...113,40 €
No products
To be determined Shipping
340,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 340,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 340,20 €
Data sheet of RPL27A-ribosomal protein L27a Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL27A-ribosomal protein L27a Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005326 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL27A |
| Origin species: | Human |
| Product name: | RPL27A-ribosomal protein L27a Gene |
| Size: | 2ug |
| Accessions: | BC005326 |
| Gene id: | 6157 |
| Gene description: | ribosomal protein L27a |
| Synonyms: | L27A; 60S ribosomal protein L27a; ribosomal protein L27a |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccatccagactgaggaagacccggaaacttaggggccacgtgagccacggccacggccgcataggcaagcaccggaagcaccccggcggccgcggtaatgctggtggtctgcatcaccaccggatcaacttcgacaaataccacccaggctactttgggaaagttggtatgaagcattaccacttaaagaggaaccagagcttctgcccaactgtcaaccttgacaaattgtggactttggtcagtgaacagacacgggtgaatgctgctaaaaacaagactggggctgctcccatcattgatgtggtgcgatcgggctactacaaagttctgggaaagggaaagctcccaaagcagcctgtcatcgtgaaggccaaattcttcagcagaagagctgaggagaagattaagagtgttgggggggcctgtgtcctggtggcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gastrin-releasing peptide - pallidin homolog (mouse) - ribosomal protein L18a - programmed cell death 6 |