RPL27A-ribosomal protein L27a Gene View larger

RPL27A-ribosomal protein L27a Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL27A-ribosomal protein L27a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL27A-ribosomal protein L27a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005326
Product type: DNA & cDNA
Ncbi symbol: RPL27A
Origin species: Human
Product name: RPL27A-ribosomal protein L27a Gene
Size: 2ug
Accessions: BC005326
Gene id: 6157
Gene description: ribosomal protein L27a
Synonyms: L27A; 60S ribosomal protein L27a; ribosomal protein L27a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccatccagactgaggaagacccggaaacttaggggccacgtgagccacggccacggccgcataggcaagcaccggaagcaccccggcggccgcggtaatgctggtggtctgcatcaccaccggatcaacttcgacaaataccacccaggctactttgggaaagttggtatgaagcattaccacttaaagaggaaccagagcttctgcccaactgtcaaccttgacaaattgtggactttggtcagtgaacagacacgggtgaatgctgctaaaaacaagactggggctgctcccatcattgatgtggtgcgatcgggctactacaaagttctgggaaagggaaagctcccaaagcagcctgtcatcgtgaaggccaaattcttcagcagaagagctgaggagaagattaagagtgttgggggggcctgtgtcctggtggcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gastrin-releasing peptide
- pallidin homolog (mouse)
- ribosomal protein L18a
- programmed cell death 6

Buy RPL27A-ribosomal protein L27a Gene now

Add to cart