Login to display prices
Login to display prices
PLDN-pallidin homolog (mouse) Gene View larger

PLDN-pallidin homolog (mouse) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLDN-pallidin homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLDN-pallidin homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004819
Product type: DNA & cDNA
Ncbi symbol: PLDN
Origin species: Human
Product name: PLDN-pallidin homolog (mouse) Gene
Size: 2ug
Accessions: BC004819
Gene id: 26258
Gene description: pallidin homolog (mouse)
Synonyms: PLDN; BLOS6; HPS9; PALLID; biogenesis of lysosome-related organelles complex 1 subunit 6; BLOC-1 subunit 6; biogenesis of lysosomal organelles complex-1, subunit 5, pallidin; biogenesis of lysosomal organelles complex-1, subunit 6, pallidin; pallid protein homolog; syntaxin 13 binding protein 1; syntaxin 13-interacting protein pallid; biogenesis of lysosomal organelles complex 1 subunit 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgtccctgggccgtcgtctccggacggggccctgacacggccaccctactgcctggaggccggggagccgacgcctggtttaagtgacacttctccagatgaagggttaatagaggacttgactatagaagacaaagcagtggagcaactggcagaaggattgctttctcattatttgccagatctgcagagatcaaaacaagccctccaggaactcacacagaaccaagttgtattgttagacacactggaacaagagatttcaaaatttaaagaatgtcattctatgttggatattaatgctttgtttgctgaggctaaacactatcatgccaagttggtgaatataagaaaagagatgctgatgcttcatgaaaaaacatcaaagttaaaaaaaagagcacttaaactgcagcagaagaggcaaaaagaagagttggaaagggagcagcaacgagagaaggagtttgaaagagaaaagcagttaactgccagaccagccaaaaggatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L18a
- programmed cell death 6
- phosphomevalonate kinase
- phospholipase C, beta 2