Cart 1 Product Products 121,50 € (empty)
-
1 x RBM9-RNA...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of PLDN-pallidin homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLDN-pallidin homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004819 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLDN |
| Origin species: | Human |
| Product name: | PLDN-pallidin homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC004819 |
| Gene id: | 26258 |
| Gene description: | pallidin homolog (mouse) |
| Synonyms: | PLDN; BLOS6; HPS9; PALLID; biogenesis of lysosome-related organelles complex 1 subunit 6; BLOC-1 subunit 6; biogenesis of lysosomal organelles complex-1, subunit 5, pallidin; biogenesis of lysosomal organelles complex-1, subunit 6, pallidin; pallid protein homolog; syntaxin 13 binding protein 1; syntaxin 13-interacting protein pallid; biogenesis of lysosomal organelles complex 1 subunit 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgtccctgggccgtcgtctccggacggggccctgacacggccaccctactgcctggaggccggggagccgacgcctggtttaagtgacacttctccagatgaagggttaatagaggacttgactatagaagacaaagcagtggagcaactggcagaaggattgctttctcattatttgccagatctgcagagatcaaaacaagccctccaggaactcacacagaaccaagttgtattgttagacacactggaacaagagatttcaaaatttaaagaatgtcattctatgttggatattaatgctttgtttgctgaggctaaacactatcatgccaagttggtgaatataagaaaagagatgctgatgcttcatgaaaaaacatcaaagttaaaaaaaagagcacttaaactgcagcagaagaggcaaaaagaagagttggaaagggagcagcaacgagagaaggagtttgaaagagaaaagcagttaactgccagaccagccaaaaggatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L18a - programmed cell death 6 - phosphomevalonate kinase - phospholipase C, beta 2 |