PMVK-phosphomevalonate kinase Gene View larger

PMVK-phosphomevalonate kinase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMVK-phosphomevalonate kinase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PMVK-phosphomevalonate kinase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006089
Product type: DNA & cDNA
Ncbi symbol: PMVK
Origin species: Human
Product name: PMVK-phosphomevalonate kinase Gene
Size: 2ug
Accessions: BC006089
Gene id: 10654
Gene description: phosphomevalonate kinase
Synonyms: HUMPMKI; PMK; PMKA; PMKASE; POROK1; testis tissue sperm-binding protein Li 95mP
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccgctgggaggcgccccgcggctggtactgctgttcagcggcaagaggaaatccgggaaggacttcgtgaccgaggcgctgcagagcagacttggagctgatgtctgtgctgtcctccggctctctggtccactcaaggaacagtatgctcaggagcatggcttgaacttccagagactcctggacaccagcacctacaaggaggcctttcggaaggacatgatccgctggggagaggagaaacgccaggctgacccaggcttcttttgcaggaagattgtggagggcatctcccagcccatctggctggtgagtgacacacggagagtgtctgacatccagtggtttcgggaggcctatggggccgtgacgcagacggtccgcgttgtagcgttggagcagagccgacagcagcggggctgggtgttcacgccaggggtggacgatgctgagtcagaatgtggcctggacaacttcggggactttgactgggtcatcgagaaccatggagttgaacagcgcctggaggagcagttggagaacctgatagaatttatccgctccagactttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phospholipase C, beta 2
- ribosomal protein L10a
- TM2 domain containing 3
- TLC domain containing 1

Buy PMVK-phosphomevalonate kinase Gene now

Add to cart