Login to display prices
Login to display prices
PMVK-phosphomevalonate kinase Gene View larger

PMVK-phosphomevalonate kinase Gene

PTXBC006089

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMVK-phosphomevalonate kinase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PMVK-phosphomevalonate kinase Gene

Proteogenix catalog: PTXBC006089
Ncbi symbol: PMVK
Product name: PMVK-phosphomevalonate kinase Gene
Size: 2ug
Accessions: BC006089
Gene id: 10654
Gene description: phosphomevalonate kinase
Synonyms: HUMPMKI; PMK; PMKA; PMKASE; POROK1; testis tissue sperm-binding protein Li 95mP
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccgctgggaggcgccccgcggctggtactgctgttcagcggcaagaggaaatccgggaaggacttcgtgaccgaggcgctgcagagcagacttggagctgatgtctgtgctgtcctccggctctctggtccactcaaggaacagtatgctcaggagcatggcttgaacttccagagactcctggacaccagcacctacaaggaggcctttcggaaggacatgatccgctggggagaggagaaacgccaggctgacccaggcttcttttgcaggaagattgtggagggcatctcccagcccatctggctggtgagtgacacacggagagtgtctgacatccagtggtttcgggaggcctatggggccgtgacgcagacggtccgcgttgtagcgttggagcagagccgacagcagcggggctgggtgttcacgccaggggtggacgatgctgagtcagaatgtggcctggacaacttcggggactttgactgggtcatcgagaaccatggagttgaacagcgcctggaggagcagttggagaacctgatagaatttatccgctccagactttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice