RPL10A-ribosomal protein L10a Gene View larger

RPL10A-ribosomal protein L10a Gene

PTXBC006791

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL10A-ribosomal protein L10a Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL10A-ribosomal protein L10a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006791
Product type: DNA & cDNA
Ncbi symbol: RPL10A
Origin species: Human
Product name: RPL10A-ribosomal protein L10a Gene
Size: 2ug
Accessions: BC006791
Gene id: 4736
Gene description: ribosomal protein L10a
Synonyms: CSA19; Csa-19; L10A; NEDD6; 60S ribosomal protein L10a; NEDD-6; neural precursor cell expressed developmentally down-regulated protein 6; ribosomal protein L10a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagcaaagtctctcgcgacaccctgtacgaggcggtgcgggaagtcctgcacgggaaccagcgcaagcgccgcaagttcctggagacggtggagttgcagatcagcttgaagaactatgatccccagaaggacaagcgcttctcgggcaccgtcaggcttaagtccactccccgccctaagttctctgtgtgtgtcctgggggaccagcagcactgtgacgaggctaaggccgtggatatcccccacatggacatcgaggcgctgaaaaaactcaacaagaataaaaaactggtcaagaagctggccaagaagtatgatgcgtttttggcctcagagtctctgatcaagcagattccacgaatcctcggcccaggtttaaataaggcaggaaagttcccttccctgctcacacacaacgaaaacatggtggccaaagtggatgaggtgaagtccacaatcaagttccaaatgaagaaggtgttatgtctggctgtagctgttggtcacgtgaagatgacagacgatgagcttgtgtataacattcacctggctgtcaacttcttggtgtcattgctcaagaaaaactggcagaatgtccgggccttatatatcaagagcaccatgggcaagccccagcgcctatattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TM2 domain containing 3
- TLC domain containing 1
- TP53 regulating kinase
- fatty acid 2-hydroxylase

Buy RPL10A-ribosomal protein L10a Gene now

Add to cart