FA2H-fatty acid 2-hydroxylase Gene View larger

FA2H-fatty acid 2-hydroxylase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FA2H-fatty acid 2-hydroxylase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FA2H-fatty acid 2-hydroxylase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017049
Product type: DNA & cDNA
Ncbi symbol: FA2H
Origin species: Human
Product name: FA2H-fatty acid 2-hydroxylase Gene
Size: 2ug
Accessions: BC017049
Gene id: 79152
Gene description: fatty acid 2-hydroxylase
Synonyms: FAAH; FAH1; FAXDC1; SCS7; SPG35; fatty acid 2-hydroxylase; fatty acid alpha-hydroxylase; fatty acid hydroxylase domain containing 1; spastic paraplegia 35 (autosomal recessive)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccaggcccatccgcctcttccactcagacctcattgagggcctctctaagactgtctggtacagtgtccccatcatctgggtgcccctggtgctgtatctcagctggtcctactaccgaacctttgcccagggcaacgtccgactcttcacgtcatttacaacagagtacacggtggcagtgcccaagtccatgttccccgggctcttcatgctggggacattcctctggagcctcatcgagtacctcatccaccgcttcctgttccacatgaagccccccagcgacagctattacctcatcatgctgcacttcgtcatgcacggccagcaccacaaggcacccttcgacggctcccgcctggtcttcccccctgtgccagcctccctggtgatcggcgtcttctacttgtgcatgcagctcatcctgcccgaggcagtagggggcactgtgtttgcggggggcctcctgggctacgtcctctatgacatgacccattactacctgcactttggctcgccgcacaagggctcctacctgtacagcctgaaggcccaccacgtcaagcaccactttgcacatcagaagtcaggatttggtatcagcactaaattgtgggattactgtttccacaccctcactccagagaaaccccacctgaagacgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SET domain containing 4
- SAP30 binding protein
- acyl-CoA thioesterase 7
- citrate lyase beta like

Buy FA2H-fatty acid 2-hydroxylase Gene now

Add to cart