ACOT7-acyl-CoA thioesterase 7 Gene View larger

ACOT7-acyl-CoA thioesterase 7 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACOT7-acyl-CoA thioesterase 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACOT7-acyl-CoA thioesterase 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017365
Product type: DNA & cDNA
Ncbi symbol: ACOT7
Origin species: Human
Product name: ACOT7-acyl-CoA thioesterase 7 Gene
Size: 2ug
Accessions: BC017365
Gene id: 11332
Gene description: acyl-CoA thioesterase 7
Synonyms: ACH1; ACT; BACH; CTE-II; LACH; LACH1; hBACH; cytosolic acyl coenzyme A thioester hydrolase; CTE-IIa; acyl-CoA thioesterase 2; acyl-CoA thioesterase, long chain; brain acyl-CoA hydrolase; long chain acyl-CoA thioester hydrolase; acyl-CoA thioesterase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggcccagacgtcgagacgccgtccgccatccagatctgccggatcatgcggccagatgatgccaacgtggccggcaatgtccacggggggaccatcctgaagatgatcgaggaggcaggcgccatcatcagcacccggcattgcaacagccagaacggggagcgctgtgtggccgccctggctcgtgtcgagcgcaccgacttcctgtctcccatgtgcatcggtgaggtggcgcatgtcagcgcggagatcacctacacctccaagcactctgtggaggtgcaggtcaacgtgatgtccgaaaacatcctcacaggtgccaaaaagctgaccaataaggccaccctgtggtatgtgcccctgtcgctgaagaatgtggacaaggtcctcgaggtgcctcctgttgtgtattcccggcaggagcaggaggaggagggccggaagcggtatgaagcccagaagctggagcgcatggagaccaagtggaggaacggggacatcgtccagccagtcctcaacccagagccgaacactgtcagctacagccagtccagcttgatccacctggtggggccttcagactgcaccctgcacggctttgtgcacggaggtgtgaccatgaagctcatggatgaggtcgccgggatcgtggctgcacgccactgcaagaccaacatcgtcacagcttccgtggacgccattaattttcatgacaagatcagaaaaggctgcgtcatcaccatctcgggacgcatgaccttcacgagcaataagtccatggagatcgaggtgttggtggacgccgaccctgttgtggacagctctcagaagcgctaccgggccgccagtgccttcttcacctacgtgtcgctgagccaggaaggcaggtcgctgcctgtgccccagctggtgcccgagaccgaggacgagaagaagcgctttgaggaaggcaaagggcggtacctgcagatgaaggcgaagcgacagggccacgcggagcctcagccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - citrate lyase beta like
- phosphoseryl-tRNA kinase
- bradykinin receptor B1
- SH3-domain GRB2-like 1

Buy ACOT7-acyl-CoA thioesterase 7 Gene now

Add to cart