Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SH3GL1-SH3-domain GRB2-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SH3GL1-SH3-domain GRB2-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001270 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SH3GL1 |
| Origin species: | Human |
| Product name: | SH3GL1-SH3-domain GRB2-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC001270 |
| Gene id: | 6455 |
| Gene description: | SH3-domain GRB2-like 1 |
| Synonyms: | CNSA1; SH3D2B; SH3P8; endophilin-A2; EEN fusion partner of MLL; SH3 domain containing GRB2 like 1; SH3 domain protein 2B; SH3 domain-containing GRB2-like protein 1; SH3-containing Grb-2-like 1 protein; SH3-domain GRB2-like 1; endophilin-2; extra 11-19 leukemia fusion; extra eleven-nineteen leukemia fusion gene protein; SH3 domain containing GRB2 like 1, endophilin A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggtggcggggctgaagaagcagttctacaaggcgagccagctggtcagtgagaaggtcggaggggccgaggggaccaagctggatgatgacttcaaagagatggagaagaaggtggatgtcaccagcaaggcggtgacagaagtgctggccaggaccatcgagtacctgcagcccaacccagcctcgcgggctaagctgaccatgctcaacacggtgtccaagatccggggccaggtgaagaaccccggctacccgcagtcggaggggcttctgggcgagtgcatgatccgccacgggaaggagctgggcggcgagtccaactttggtgacgcattgctggatgccggcgagtccatgaagcgcctggcagaggtgaaggactccctggacatcgaggtcaagcagaacttcattgaccccctccagaacctgtgcgagaaagacctgaaggagatccagcaccacctgaagaaactggagggccgccgcctggactttgactacaagaagaagcggcagggcaagatccccgatgaggagctacgccaggcgctggagaagttcgaggagtccaaggaggtggcagaaaccagcatgcacaacctcctggagactgacatcgagcaggtgagtcagctctcggccctggtggatgcacagctggactaccaccggcaggccgtgcagatcctggacgagctggcggagaagctcaagcgcaggatgcgggaagcttcctcacgccctaagcgggagtataagccgaagccccgggagccctttgaccttggagagcctgagcagtccaacgggggcttcccctgcaccacagcccccaagatcgcagcttcatcgtctttccgatcttccgacaagcccatccggacccctagccggagcatgccgcccctggaccagccgagctgcaaggcgctgtacgacttcgagcccgagaacgacggggagctgggcttccatgagggcgacgtcatcacgctgaccaaccagatcgatgagaactggtacgagggcatgctggacggccagtcgggcttcttcccgctcagctacgtggaggtgcttgtgcccctgccgcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - somatostatin receptor 2 - ADP-ribosyltransferase 3 - somatostatin receptor 1 - ZXD family zinc finger C |