ZXDC-ZXD family zinc finger C Gene View larger

ZXDC-ZXD family zinc finger C Gene

PTXBC002940

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZXDC-ZXD family zinc finger C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZXDC-ZXD family zinc finger C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002940
Product type: DNA & cDNA
Ncbi symbol: ZXDC
Origin species: Human
Product name: ZXDC-ZXD family zinc finger C Gene
Size: 2ug
Accessions: BC002940
Gene id: 79364
Gene description: ZXD family zinc finger C
Synonyms: zinc finger protein ZXDC; ZXDL; SERH2790; ZXD-like zinc finger protein; ZXD family zinc finger C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcgcacatggtcagacagcacagccggcgccaagatctcttacctcagctagaagctccgagttctcttactcccagcagtgaactcagcagcccaggccaaagtgagctcactaacatggatcttgctgcactcttctctgacacacctgccaatgctagtggttctgcaggtgggtcggatgaggctctgaactccggaatcctgactattgacgtcacttctgtgagctcctctctgggagggaacctccctgctaataatagctccctagggccgatggaacccctggtcctggtggcccacagtgatattcccccaagcctggacagccctctggttctcgggacagcagccacggttctgcagcagggcagcttcagtgtggatgacgtgcagactgtgagtgcaggagcattaggctgtctggtggctctgcccatgaagaacttgagtgacgacccactggctttgacctccaatagtaacttagcagcacatatcaccacaccgacctcttcgagcaccccccgagaaaatgccagtgtcccggaactgctggctccaatcaaggtggagccggactcgccttctcgcccaggagcagttgggcagcaggaaggaagccatgggctgccccagtccacgttgcccagtccagcagagcagcacggtgcccaggacacagagctcagtgcaggcactggcaacttctatttggaaagtgggggctcagcaagaactgattaccgagccattcaactagccaaggaaaaaaagcagagaggagcggggagcaatgcaggagcctcacagtctactcagagaaaaataaaagaaggcaaaatgagtcctccccatttccatgcaagccagaacagttggttgtgtgggagcctcgtggtgcccagcggaggacggccaggaccagctccagcagctggggtgcagtgcggggcgcagggcgtccaggtccagctggtgcaggatgacccctccggcgaaggtgtcctgccctcggcccgcggcccagccaccttcctccccttcctcactgtggacctgcccgtctacgtcctccaggaggtgctcccctcatctggaggccctgctggaccggaggccacccagttcccaggaagcactatcaacctgcaggatctgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cystinosis, nephropathic
- docking protein 2, 56kDa
- casein kinase 1, delta
- transmembrane protein 5

Buy ZXDC-ZXD family zinc finger C Gene now

Add to cart