ART3-ADP-ribosyltransferase 3 Gene View larger

ART3-ADP-ribosyltransferase 3 Gene


New product

121,50 € tax excl.

Data sheet of ART3-ADP-ribosyltransferase 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ART3-ADP-ribosyltransferase 3 Gene

Proteogenix catalog: PTXBC008397
Ncbi symbol: ART3
Product name: ART3-ADP-ribosyltransferase 3 Gene
Size: 2ug
Accessions: BC008397
Gene id: 419
Gene description: ADP-ribosyltransferase 3
Synonyms: ARTC3; ecto-ADP-ribosyltransferase 3; ADP-ribosyltransferase C2 and C3 toxin-like 3; NAD(P)(+)--arginine ADP-ribosyltransferase 3; mono(ADP-ribosyl)transferase 3; mono-ADP-ribosyltransferase; ADP-ribosyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagacgggacattttgaaatagtcaccatgctgctggcaaccatgattctagtggacattttccaggtgaaggctgaagtgttagacatggcagataatgcatttgatgatgaatacctgaaatgtacggacaggatggaaattaaatacgttccccaactgctaaaggaggaaaaagcaagccaccagcaattagatactgtgtgggaaaatgcaaaagccaaatgggcagcccgaaagactcaaatctttctccctatgaattttaaggataaccatggaatagccctgatggcatatatttccgaagctcaagagcaaactcccttttaccatctgttcagtgaagctgtgaagatggctggccaatctcgagaagattatatctatggcttccagttcaaagctttccacttttacctcacaagagccctgcagttgctgagaaaaccttgtgaggccagttccaaaactgtggtatatagaacaagccagggcacttcatttacatttggagggctaaaccaagccaggtttggccattttaccttggcatattcagccaaacctcaggctgctaatgaccagctcactgtgttatccatctacacatgccttggagttgacattgaaaattttcttgataaagaaagtgaaagaattactttaatacctctgaatgaggtttttcaagtgtcacaggagggggctggcaataaccttatccttcaaagcataaacaagacctgcagccattatgagtgtgcatttctaggtggactaaaaaccgaaaactgtattgagaacctagaatattttcaacccatctatgtctacaaccctggtgagaaaaaccagaagcttgaagaccatagtgagaaaaactggaagcttgaagaccatggtgagaaaaaccagaagcttgaagaccatggtgtgaaaatccttgaacccacccaaatacctggaatgaaaattccagaaccttttccactacctgaagataaaagtcaaggaaatatcaacaatcctactccaggtccagttcctgttccaggtcccaaaagccatccttctgcatccttgggcaaactgctgcttccacagtttgggatggtcatcattttaatcagtgtttctgctataaatctctttgttgctctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy ART3-ADP-ribosyltransferase 3 Gene now

Add to cart