BDKRB1-bradykinin receptor B1 Gene View larger

BDKRB1-bradykinin receptor B1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BDKRB1-bradykinin receptor B1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BDKRB1-bradykinin receptor B1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034705
Product type: DNA & cDNA
Ncbi symbol: BDKRB1
Origin species: Human
Product name: BDKRB1-bradykinin receptor B1 Gene
Size: 2ug
Accessions: BC034705
Gene id: 623
Gene description: bradykinin receptor B1
Synonyms: B1BKR; B1R; BDKRB2; BKB1R; BKR1; BRADYB1; B1 bradykinin receptor; BK-1 receptor; bradykinin B1 receptor; bradykinin receptor 1; bradykinin receptor B2; bradykinin receptor B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatcatcctggccccctctagagctccaatcctccaaccagagccagctcttccctcaaaatgctacggcctgtgacaatgctccagaagcctgggacctgctgcacagagtgctgccgacatttatcatctccatctgtttcttcggcctcctagggaacctttttgtcctgttggtcttcctcctgccccggcggcaactgaacgtggcagaaatctacctggccaacctggcagcctctgatctggtgtttgtcttgggcttgcccttctgggcagagaatatctggaaccagtttaactggcctttcggagccctcctctgccgtgtcatcaacggggtcatcaaggccaatttgttcatcagcatcttcctggtggtggccatcagccaggaccgctaccgcgtgctggtgcaccctatggccagccggaggcagcagcggcggaggcaggcccgggtcacctgcgtgctcatctgggttgtggggggcctcttgagcatccccacattcctgctgcgatccatccaagccgtcccagatctgaacatcaccgcctgcatcctgctcctcccccatgaggcctggcactttgcaaggattgtggagttaaatattctgggtttcctcctaccactggctgcgatcgtcttcttcaactaccacatcctggcctccctgcgaacgcgggaggaggtcagcaggacaaggtgcgggggccgcaaggatagcaagaccacagcgctgatcctcacgctcgtggttgccttcctggtctgctgggccccttaccacttctttgccttcctggaattcttattccaggtgcaagcagtccgaggctgcttttgggaggacttcattgacctgggcctgcaattggccaacttctttgccttcactaacagctccctgaatccagtaatttatgtctttgtgggccggctcttcaggaccaaggtctgggaactttataaacaatgcacccctaaaagtcttgctccaatatcttcatcccataggaaagaaatcttccaacttttctggcggaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3-domain GRB2-like 1
- somatostatin receptor 2
- ADP-ribosyltransferase 3
- somatostatin receptor 1

Buy BDKRB1-bradykinin receptor B1 Gene now

Add to cart