SETD4-SET domain containing 4 Gene View larger

SETD4-SET domain containing 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SETD4-SET domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SETD4-SET domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002898
Product type: DNA & cDNA
Ncbi symbol: SETD4
Origin species: Human
Product name: SETD4-SET domain containing 4 Gene
Size: 2ug
Accessions: BC002898
Gene id: 54093
Gene description: SET domain containing 4
Synonyms: C21orf18; C21orf27; SET domain-containing protein 4; SET domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagaaaggaaaagggagaacaagccggatcagaagacgaaaactctgcggaagttctgaatcaagaggagtgaatgagagccacaagtctgaatttatagagctgaggaagtggctgaaagctaggaagtttcaagattcaaacttagcgcctgcttgttttccaggtacaggaagagggctgatgagtcaaacatccctgcaggagggacagatgattatttcgttgcctgagagttgcctgctcaccacggacacagtgattcgaagctacttaggggcatacattactaagtggaagcctcctccatctcctctgctggcgctgtgcacctttttagtttcagaaaagcatgctgggcaccgatctctttggaagccttacctggagattttacccaaggcgtatacctgccctgtttgtttggagccggaagtggtgaaccttcttcccaaatctttaaaagcaaaggctgaagagcagagagcccacgtgcaggagttctttgcttcctccagagactttttctcttctctgcagcctctgtttgcggaggctgttgacagcatcttcagctacagtgccctgctgtgggcttggtgcaccgtcaacaccagagccgtgtacctgaggcccaggcagcgggaatgcctttctgcagagccggacacctgtgcactcgctccgtacctggacctgctgaatcatagcccacatgtccaggtaaaagcagcgtttaatgaagaaactcattcttacgaaattagaacgacttcacgttggagaaagcatgaagaggtattcatctgttacggccctcacgataatcaacggctgttcctggaatacggatttgtttctgtccataatcctcatgcttgtgtttatgtctcaagaggttggaatcaactttgttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SAP30 binding protein
- acyl-CoA thioesterase 7
- citrate lyase beta like
- phosphoseryl-tRNA kinase

Buy SETD4-SET domain containing 4 Gene now

Add to cart