SAP30BP-SAP30 binding protein Gene View larger

SAP30BP-SAP30 binding protein Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAP30BP-SAP30 binding protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SAP30BP-SAP30 binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007592
Product type: DNA & cDNA
Ncbi symbol: SAP30BP
Origin species: Human
Product name: SAP30BP-SAP30 binding protein Gene
Size: 2ug
Accessions: BC007592
Gene id: 29115
Gene description: SAP30 binding protein
Synonyms: HCNGP; HTRG; SAP30-binding protein; HSV-1 binding; transcriptional regulator protein HCNGP; SAP30 binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggggaagaagaatgttctgtcgtctctcgcagtttacgcggaagattcagagcccgagtctgatggcgaggctggaatcgaggcggtgggcagcgcggctgaggagaaaggcggattggtatctgatgcctatggggaggatgacttttctcgtctagggggtgatgaagatggttatgaagaagaagaagatgagaacagtagacagtcggaagatgacgattcagagactgaaaaacctgaggctgatgacccaaaggataatacagaagcagaaaagcgagacccccaggaactcgtggcctccttttctgaaagagttcggaacatgtcgcctgatgaaatcaagatcccgccagaaccccctggcagatgttcaaatcacttgcaagacaagatccagaagctttatgaacgaaagataaaggagggaatggatatgaactacattatccaaaggaagaaagaatttcggaaccctagcatctacgagaagctgatccagttctgtgccattgacgagcttggcaccaactacccaaaggatatgtttgatccccatggctggtctgaggactcctactatgaggcattagccaaggcccagaaaattgagatggacaaattggaaaaggccaaaaaggagcgaacaaaaattgagtttgtgacgggcaccaaaaaaggcaccacgaccaacgccacgtccaccaccactaccactgccagcacagctgttgcagatgctcagaagagaaagagcaagtgggattcggctatcccagtgacaacgatagcccagcccaccatcctcaccaccacagccaccctgccagctgttgtcacggtcaccaccagcgccagcggctccaagaccaccgtcatctctgctgtgggcaccattgtgaagaaggccaagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-CoA thioesterase 7
- citrate lyase beta like
- phosphoseryl-tRNA kinase
- bradykinin receptor B1

Buy SAP30BP-SAP30 binding protein Gene now

Add to cart