TLCD1-TLC domain containing 1 Gene View larger

TLCD1-TLC domain containing 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TLCD1-TLC domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TLCD1-TLC domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014072
Product type: DNA & cDNA
Ncbi symbol: TLCD1
Origin species: Human
Product name: TLCD1-TLC domain containing 1 Gene
Size: 2ug
Accessions: BC014072
Gene id: 116238
Gene description: TLC domain containing 1
Synonyms: calfacilitin; TLC domain-containing protein 1; TLC domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccgactgctgcaccccgccctgccgctgctcctgggcgccacgctgaccttccgggcgctccggcgcgcgctctgtcgcctgcccctacccgtgcacgtgcgcgccgaccccctgcgcacctggcgctggcacaacctgctcgtctccttcgctcactccattgtgtcggggatctgggcactgctgtgtgtatggcagactcctgacatgttagtggagattgagacggcgtggtcactttctggctatttgctcgtttgcttctctgcggggtatttcatccacgatacggtggacatcgtggctagcggacagacgcgagcctcttgggaataccttgtccatcacgtcatggccatgggtgccttcttctccggcatcttttggagcagctttgtcggtgggggtgtcttaacactactggtggaagtcagcaacatcttcctcaccattcgcatgatgatgaaaatcagtaatgcccaggatcatctcctctaccgggttaacaagtatgtgaacctggtcatgtactttctcttccgcctggcccctcaggcctacctcacccatttcttcttgcgttatgtgaaccagaggaccctgggcaccttcctgctgggtatcctgctcatgctggacgtgatgatcataatctacttttcccgcctcctccgctctgacttctgccctgagcatgtccccaagaagcaacacaaagacaagttcttgactgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TP53 regulating kinase
- fatty acid 2-hydroxylase
- SET domain containing 4
- SAP30 binding protein

Buy TLCD1-TLC domain containing 1 Gene now

Add to cart