TM2D3-TM2 domain containing 3 Gene View larger

TM2D3-TM2 domain containing 3 Gene

PTXBC006150

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM2D3-TM2 domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TM2D3-TM2 domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006150
Product type: DNA & cDNA
Ncbi symbol: TM2D3
Origin species: Human
Product name: TM2D3-TM2 domain containing 3 Gene
Size: 2ug
Accessions: BC006150
Gene id: 80213
Gene description: TM2 domain containing 3
Synonyms: BLP2; TM2 domain-containing protein 3; BBP-like protein 2; beta-amyloid-binding protein-like protein 2; TM2 domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggaggggtgcgcccgctgaggggcctccgcgccttgtgtcgcgtgctgctcttcctctcgcagttctgcattctgtcgggcggtgagcaatcgcaggcgctggctcagtcaataaaggatccgggcccaacacgcacattcacagtagttcccagggcagcagaaagtactgaaatcccaccttatgtgatgaagtgtccgagcaatggtttgtgtagcaggcttcctgcagactgtatagactgcacaacaaatttctcctgtacctatgggaagcctgtcacttttgactgtgcagtgaaaccatctgttacctgtgttgatcaagacttcaaatcccaaaagaacttcatcattaacatgacttgcagattttgctggcagcttcctgaaacagattacgagtgtaccaactccaccagctgcatgacggtgtcctgtcctcggcagcgctaccctgccaactgcacggtgcgggaccacgtccactgcttgggtaaccgtacttttcccaaaatgctatattgcaattggactggaggctataagtggtctacggctctggctctaagcatcaccctcggtgggtttggagcagaccgtttctacctgggccagtggcgggaaggcctcggcaagctcttcagcttcggtggcctgggaatatggacgctgatagacgtcctgctcattggagttggctatgttggaccagcagatggctctttgtacatttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TLC domain containing 1
- TP53 regulating kinase
- fatty acid 2-hydroxylase
- SET domain containing 4

Buy TM2D3-TM2 domain containing 3 Gene now

Add to cart