Login to display prices
Login to display prices
PLCB2-phospholipase C, beta 2 Gene View larger

PLCB2-phospholipase C, beta 2 Gene

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLCB2-phospholipase C, beta 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PLCB2-phospholipase C, beta 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000939
Product type: DNA & cDNA
Ncbi symbol: PLCB2
Origin species: Human
Product name: PLCB2-phospholipase C, beta 2 Gene
Size: 2ug
Accessions: BC000939
Gene id: 5330
Gene description: phospholipase C, beta 2
Synonyms: PLC-beta-2; 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-2; phosphoinositide phospholipase C-beta-2; phospholipase C beta 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctctgctcaaccctgtcctgctgccccccaaggtgaaggcctatctgagccaaggggagcgcttcatcaaatgggatgatgaaactacagttgcctctccagttatcctccgtgtggatcctaagggctactacttatactggacgtatcaaagtaaggagatggagtttctggatatcaccagcatccgggatactcgctttgggaagtttgccaagatgcccaagagccagaagctccgggacgtcttcaacatggactttcctgataacagtttcctgctgaagacactcacggtggtgtccggcccggacatggtggacctcaccttccacaacttcgtctcctacaaggagaacgtgggcaaggcctgggctgaggacgtactggccctagtcaaacatccgctgacggccaacgcctcccgcagcaccttcctggacaagatccttgtgaagctcaagatgcagctcaactctgaagggaagattccggtgaagaactttttccagatgtttcctgctgaccgcaagcgggtggaagctgctctcagtgcctgccacctccccaaaggcaaacctggaggagcgagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L10a
- TM2 domain containing 3
- TLC domain containing 1
- TP53 regulating kinase