RPL18A-ribosomal protein L18a Gene View larger

RPL18A-ribosomal protein L18a Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL18A-ribosomal protein L18a Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPL18A-ribosomal protein L18a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007512
Product type: DNA & cDNA
Ncbi symbol: RPL18A
Origin species: Human
Product name: RPL18A-ribosomal protein L18a Gene
Size: 2ug
Accessions: BC007512
Gene id: 6142
Gene description: ribosomal protein L18a
Synonyms: L18A; 60S ribosomal protein L18a; ribosomal protein L18a-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcctcgggcacgctacgagagtacaaggtagtgggtcgctgcctgcccacccccaaatgccacacgccgcccctctaccgcatgcgaatctttgcgcctaatcatgtcgtcgccaagtcccgcttctggtactttgtatctcagttaaagaagatgaagaagtcttcaggggagattgtctactgtgggcaggtgtttgagaagtcccccctgcgggtgaagaacttcgggatctggctgcgctatgactcccggagcggcacccacaacatgtaccgggaataccgggacctgaccaccgcaggcgctgtcacccagtgctaccgagacatgggtgcccggcaccgcgcccgagcccactccattcagatcatgaaggtggaggagatcgcggccagcaagtgccgccggccggctgtcaagcagttccacgactccaagatcaagttcccgctgccccaccgggtcctgcgccgtcagcacaagccacgcttcaccaccaagaggcccaacaccttcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - programmed cell death 6
- phosphomevalonate kinase
- phospholipase C, beta 2
- ribosomal protein L10a

Buy RPL18A-ribosomal protein L18a Gene now

Add to cart