Login to display prices
Login to display prices
RPL18A-ribosomal protein L18a Gene View larger

RPL18A-ribosomal protein L18a Gene

PTXBC007512

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL18A-ribosomal protein L18a Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL18A-ribosomal protein L18a Gene

Proteogenix catalog: PTXBC007512
Ncbi symbol: RPL18A
Product name: RPL18A-ribosomal protein L18a Gene
Size: 2ug
Accessions: BC007512
Gene id: 6142
Gene description: ribosomal protein L18a
Synonyms: L18A; 60S ribosomal protein L18a; ribosomal protein L18a-like protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcctcgggcacgctacgagagtacaaggtagtgggtcgctgcctgcccacccccaaatgccacacgccgcccctctaccgcatgcgaatctttgcgcctaatcatgtcgtcgccaagtcccgcttctggtactttgtatctcagttaaagaagatgaagaagtcttcaggggagattgtctactgtgggcaggtgtttgagaagtcccccctgcgggtgaagaacttcgggatctggctgcgctatgactcccggagcggcacccacaacatgtaccgggaataccgggacctgaccaccgcaggcgctgtcacccagtgctaccgagacatgggtgcccggcaccgcgcccgagcccactccattcagatcatgaaggtggaggagatcgcggccagcaagtgccgccggccggctgtcaagcagttccacgactccaagatcaagttcccgctgccccaccgggtcctgcgccgtcagcacaagccacgcttcaccaccaagaggcccaacaccttcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice