GRP-gastrin-releasing peptide Gene View larger

GRP-gastrin-releasing peptide Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRP-gastrin-releasing peptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GRP-gastrin-releasing peptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004488
Product type: DNA & cDNA
Ncbi symbol: GRP
Origin species: Human
Product name: GRP-gastrin-releasing peptide Gene
Size: 2ug
Accessions: BC004488
Gene id: 2922
Gene description: gastrin-releasing peptide
Synonyms: prepro-GRP; GRP-10; preproGRP; proGRP; gastrin-releasing peptide; bombesin; neuromedin C; pre-progastrin releasing peptide; testicular tissue protein Li 103
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcggccgtgagctcccgctggtcctgctggcgctggtcctctgcctggcgccccgggggcgagcggtcccgctgcctgcgggcggagggaccgtgctgaccaagatgtacccgcgcggcaaccactgggcggtggggcacttaatggggaaaaagagcacaggggagtcttcttctgtttctgagagagggagcctgaagcagcagctgagagagtacatcaggtgggaagaagctgcaaggaatttgctgggtctcatagaagcaaaggagaacagaaaccaccagccacctcaacccaaggccctgggcaatcagcagccttcgtgggattcagaggatagcagcaacttcaaagatgtaggttcaaaaggcaaagttggtagactctctgctccaggttctcaacgtgaaggaaggaacccccagctgaaccagcaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pallidin homolog (mouse)
- ribosomal protein L18a
- programmed cell death 6
- phosphomevalonate kinase

Buy GRP-gastrin-releasing peptide Gene now

Add to cart