Login to display prices
Login to display prices
DTWD1-DTW domain containing 1 Gene View larger

DTWD1-DTW domain containing 1 Gene

PTXBC018028

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DTWD1-DTW domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DTWD1-DTW domain containing 1 Gene

Proteogenix catalog: PTXBC018028
Ncbi symbol: DTWD1
Product name: DTWD1-DTW domain containing 1 Gene
Size: 2ug
Accessions: BC018028
Gene id: 56986
Gene description: DTW domain containing 1
Synonyms: MDS009; DTW domain-containing protein 1; x 009 protein; DTW domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctctcaatccacctatatttctcaaacgaagtgaagaaaatagttcaaaatttgtggaaacaaaacagtcacaaactacttccatagcttcagaagatccccttcaaaacttatgtttagcatctcaagaagttcttcaaaaagctcagcaaagtgggagatcaaaatgtctcaaatgtggtggttccagaatgttctactgctatacatgttatgttccagttgaaaatgtacctattgaacagattccacttgtgaagtttagcctatatcatcttggccagtccatggtctcctcagcatctaaaatcacatgtataggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: