FRZB-frizzled-related protein Gene View larger

FRZB-frizzled-related protein Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FRZB-frizzled-related protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FRZB-frizzled-related protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027855
Product type: DNA & cDNA
Ncbi symbol: FRZB
Origin species: Human
Product name: FRZB-frizzled-related protein Gene
Size: 2ug
Accessions: BC027855
Gene id: 2487
Gene description: frizzled-related protein
Synonyms: FRZB-PEN; FRZB-1; FRE; FRITZ; FRP-3; FRZB1; FZRB; OS1; SFRP3; SRFP3; hFIZ; secreted frizzled-related protein 3; frezzled; frizzled homolog-related; frizzled-related protein 1; sFRP-3; frizzled-related protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctgcggcagcccgggagggatgctgctgctgcgggccgggctgcttgccctggctgctctctgcctgctccgggtgcccggggctcgggctgcagcctgtgagcccgtccgcatccccctgtgcaagtccctgccctggaacatgactaagatgcccaaccacctgcaccacagcactcaggccaacgccatcctggccatcgagcagttcgaaggtctgctgggcacccactgcagccccgatctgctcttcttcctctgtgccatgtacgcgcccatctgcaccattgacttccagcacgagcccatcaagccctgtaagtctgtgtgcgagcgggcccggcagggctgtgagcccatactcatcaagtaccgccactcgtggccggagaacctggcctgcgaggagctgccagtgtacgacaggggcgtgtgcatctctcccgaggccatcgttactgcggacggagctgattttcctatggattctagtaacggaaactgtagaggggcaagcagtgaacgctgtaaatgtaagcctattagagctacacagaagacctatttccggaacaattacaactatgtcattcgggctaaagttaaagagataaagactaagtgccatgatgtgactgcagtagtggaggtgaaggagattctaaagtcctctctggtaaacattccacgggacactgtcaacctctataccagctctggctgcctctgccctccacttaatgttaatgaggaatatatcatcatgggctatgaagatgaggaacgttccagattactcttggtggaaggctctatagctgagaagtggaaggatcgactcggtaaaaaagttaagcgctgggatatgaagcttcgtcatcttggactcagtaaaagtgattctagcaatagtgattccactcagagtcagaagtctggcaggaactcgaacccccggcaagcacgcaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - programmed cell death 6
- BEN domain containing 7
- UBA domain containing 1
- N-myristoyltransferase 2

Buy FRZB-frizzled-related protein Gene now

Add to cart