Cart 6 Product Products 1 215,75 € (empty)
No products
To be determined Shipping
1 215,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 215,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 215,75 €
Data sheet of FRZB-frizzled-related protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FRZB-frizzled-related protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027855 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FRZB |
| Origin species: | Human |
| Product name: | FRZB-frizzled-related protein Gene |
| Size: | 2ug |
| Accessions: | BC027855 |
| Gene id: | 2487 |
| Gene description: | frizzled-related protein |
| Synonyms: | FRZB-PEN; FRZB-1; FRE; FRITZ; FRP-3; FRZB1; FZRB; OS1; SFRP3; SRFP3; hFIZ; secreted frizzled-related protein 3; frezzled; frizzled homolog-related; frizzled-related protein 1; sFRP-3; frizzled-related protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtctgcggcagcccgggagggatgctgctgctgcgggccgggctgcttgccctggctgctctctgcctgctccgggtgcccggggctcgggctgcagcctgtgagcccgtccgcatccccctgtgcaagtccctgccctggaacatgactaagatgcccaaccacctgcaccacagcactcaggccaacgccatcctggccatcgagcagttcgaaggtctgctgggcacccactgcagccccgatctgctcttcttcctctgtgccatgtacgcgcccatctgcaccattgacttccagcacgagcccatcaagccctgtaagtctgtgtgcgagcgggcccggcagggctgtgagcccatactcatcaagtaccgccactcgtggccggagaacctggcctgcgaggagctgccagtgtacgacaggggcgtgtgcatctctcccgaggccatcgttactgcggacggagctgattttcctatggattctagtaacggaaactgtagaggggcaagcagtgaacgctgtaaatgtaagcctattagagctacacagaagacctatttccggaacaattacaactatgtcattcgggctaaagttaaagagataaagactaagtgccatgatgtgactgcagtagtggaggtgaaggagattctaaagtcctctctggtaaacattccacgggacactgtcaacctctataccagctctggctgcctctgccctccacttaatgttaatgaggaatatatcatcatgggctatgaagatgaggaacgttccagattactcttggtggaaggctctatagctgagaagtggaaggatcgactcggtaaaaaagttaagcgctgggatatgaagcttcgtcatcttggactcagtaaaagtgattctagcaatagtgattccactcagagtcagaagtctggcaggaactcgaacccccggcaagcacgcaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - programmed cell death 6 - BEN domain containing 7 - UBA domain containing 1 - N-myristoyltransferase 2 |