Login to display prices
Login to display prices
CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene View larger

CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene

PTXBC066300

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC066300
Ncbi symbol: CDC26
Product name: CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC066300
Gene id: 246184
Gene description: cell division cycle 26 homolog (S. cerevisiae)
Synonyms: CDC26 subunit of anaphase promoting complex; anaphase-promoting complex subunit CDC26; ANAPC12; APC12; C9orf17; anaphase-promoting complex subunit 12; cell division cycle 26 homolog; cell division cycle protein 26 homolog; cell division cycle 26
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagacggaaaccaacacgcctagagctaaagcttgatgacattgaagagtttgagaacattcgaaaggacctggagacccgtaagaaacagaaggaagatgtggaagttgtaggaggcagtgatggagaaggagccattgggcttagcagtgatcccaagagccgggaacaaatgatcaatgatcggattggttataaaccccaacccaagcccaataatcgttcatctcaatttggaagtcttgaattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: