Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC066300 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC26 |
| Origin species: | Human |
| Product name: | CDC26-cell division cycle 26 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC066300 |
| Gene id: | 246184 |
| Gene description: | cell division cycle 26 homolog (S. cerevisiae) |
| Synonyms: | CDC26 subunit of anaphase promoting complex; anaphase-promoting complex subunit CDC26; ANAPC12; APC12; C9orf17; anaphase-promoting complex subunit 12; cell division cycle 26 homolog; cell division cycle protein 26 homolog; cell division cycle 26 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagacggaaaccaacacgcctagagctaaagcttgatgacattgaagagtttgagaacattcgaaaggacctggagacccgtaagaaacagaaggaagatgtggaagttgtaggaggcagtgatggagaaggagccattgggcttagcagtgatcccaagagccgggaacaaatgatcaatgatcggattggttataaaccccaacccaagcccaataatcgttcatctcaatttggaagtcttgaattttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - candidate tumor suppressor in ovarian cancer 2 - phosphotyrosine interaction domain containing 1 - cell division cycle 16 homolog (S. cerevisiae) - beaded filament structural protein 1, filensin |