Login to display prices
Login to display prices
MRPL1-mitochondrial ribosomal protein L1 Gene View larger

MRPL1-mitochondrial ribosomal protein L1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL1-mitochondrial ribosomal protein L1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL1-mitochondrial ribosomal protein L1 Gene

Proteogenix catalog: PTXBC014356
Ncbi symbol: MRPL1
Product name: MRPL1-mitochondrial ribosomal protein L1 Gene
Size: 2ug
Accessions: BC014356
Gene id: 65008
Gene description: mitochondrial ribosomal protein L1
Synonyms: BM022; L1MT; MRP-L1; 39S ribosomal protein L1, mitochondrial; mitochondrial ribosomal protein L1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtttatcagacatcactttgttcttgttctgtaaacatccgagtgcccaacagacattttgctgctgctacaaagtctgcaaagaaaacaaaaaaaggtgctaaagaaaaaacaccagatgagaaaaaagatgaaatagaaaaaataaaagcatatccctatatggaaggcgaacctgaggatgatgtctatttaaaacgcttatacccgagacagatatatgaggtggagaaagctgttcacttacttaagaaatttcaaattcttgactttactagtccaaagcaaagtgtttatcttgatttgacactggatatggcactgggaaagaagaaaaacgtggagccatttaccagtgttcttagtttgccatacccatttgcttccgaaatcaataaagttgctgtatttacagagaatgcatcagaggtcaaaatagcggaagaaaatggagctgcatttgcaggaggcactagtctgatacagaagatttgggatgatgaaattgttgcagacttttacgtagctgttccagaaataatgcctgaacttaatcgattaaggaagaaactgaataaaaaatatccaaagctttctcgaaattccattggccgtgacatccccaaaatgcttgaattatttaaaaatggacatgaaattaaggtagatgaagaaagggagaactttctccagaccaaaatagcaacattggatatgtcaagtgaccagatagctgccaatctgcaagcagttattaatgaagtttgtaggcacagaccgctgaatttgggtccctttgtggtacgtgctttccttcgtagttcaacaagtgaaggtttattactgaagattgatccattgttgcctaaagaagtaaaaaatgaagaaagtgaaaaagaagatgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: