MRPL1-mitochondrial ribosomal protein L1 Gene View larger

MRPL1-mitochondrial ribosomal protein L1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL1-mitochondrial ribosomal protein L1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL1-mitochondrial ribosomal protein L1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014356
Product type: DNA & cDNA
Ncbi symbol: MRPL1
Origin species: Human
Product name: MRPL1-mitochondrial ribosomal protein L1 Gene
Size: 2ug
Accessions: BC014356
Gene id: 65008
Gene description: mitochondrial ribosomal protein L1
Synonyms: BM022; L1MT; MRP-L1; 39S ribosomal protein L1, mitochondrial; mitochondrial ribosomal protein L1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtttatcagacatcactttgttcttgttctgtaaacatccgagtgcccaacagacattttgctgctgctacaaagtctgcaaagaaaacaaaaaaaggtgctaaagaaaaaacaccagatgagaaaaaagatgaaatagaaaaaataaaagcatatccctatatggaaggcgaacctgaggatgatgtctatttaaaacgcttatacccgagacagatatatgaggtggagaaagctgttcacttacttaagaaatttcaaattcttgactttactagtccaaagcaaagtgtttatcttgatttgacactggatatggcactgggaaagaagaaaaacgtggagccatttaccagtgttcttagtttgccatacccatttgcttccgaaatcaataaagttgctgtatttacagagaatgcatcagaggtcaaaatagcggaagaaaatggagctgcatttgcaggaggcactagtctgatacagaagatttgggatgatgaaattgttgcagacttttacgtagctgttccagaaataatgcctgaacttaatcgattaaggaagaaactgaataaaaaatatccaaagctttctcgaaattccattggccgtgacatccccaaaatgcttgaattatttaaaaatggacatgaaattaaggtagatgaagaaagggagaactttctccagaccaaaatagcaacattggatatgtcaagtgaccagatagctgccaatctgcaagcagttattaatgaagtttgtaggcacagaccgctgaatttgggtccctttgtggtacgtgctttccttcgtagttcaacaagtgaaggtttattactgaagattgatccattgttgcctaaagaagtaaaaaatgaagaaagtgaaaaagaagatgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L4
- HLA-B associated transcript 2-like
- mitochondrial ribosomal protein L3
- complement component 5a receptor 1

Buy MRPL1-mitochondrial ribosomal protein L1 Gene now

Add to cart