C5AR1-complement component 5a receptor 1 Gene View larger

C5AR1-complement component 5a receptor 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5AR1-complement component 5a receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C5AR1-complement component 5a receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008982
Product type: DNA & cDNA
Ncbi symbol: C5AR1
Origin species: Human
Product name: C5AR1-complement component 5a receptor 1 Gene
Size: 2ug
Accessions: BC008982
Gene id: 728
Gene description: complement component 5a receptor 1
Synonyms: C5A; C5AR; C5R1; CD88; C5a anaphylatoxin chemotactic receptor 1; C5a anaphylatoxin receptor; C5a ligand; C5a-R; complement component 5 receptor 1; complement component 5a receptor 1; complement C5a receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactccttcaattataccacccctgattatgggcactatgatgacaaggataccctggacctcaacacccctgtggataaaacttctaacacgctgcgtgttccagacatcctggccttggtcatctttgcagtcgtcttcctggtgggagtgctgggcaatgccctggtggtctgggtgacggcattcgaggccaagcggaccatcaatgccatctggttcctcaacttggcggtagccgacttcctctcctgcctggcgctgcccatcttgttcacgtccattgtacagcatcaccactggccctttggcggggccgcctgcagcatcctgccctccctcatcctgctcaacatgtacgccagcatcctgctcctggccaccatcagcgccgaccgctttctgctggtgtttaaacccatctggtgccagaacttccgaggggccggcttggcctggatcgcctgtgccgtggcttggggtttagccctgctgctgaccataccctccttcctgtaccgggtggtccgggaggagtactttccaccaaaggtgttgtgtggcgtggactacagccacgacaaacggcgggagcgagccgtggccatcgtccggctggtcctgggcttcctgtggcctctactcacgctcacgatttgttacactttcatcctgctccggacgtggagccgcagggccacgcggtccaccaagacactcaaggtggtggtggcagtggtggccagtttctttatcttctggttgccctaccaggtgacggggataatgatgtccttcctggagccatcgtcacccaccttcctgctgctgaataagctggactccctgtgtgtctcctttgcctacatcaactgctgcatcaaccccatcatctacgtggtggccggccagggcttccagggccgactgcggaaatccctccccagcctcctccggaacgtgttgactgaagagtccgtggttagggagagcaagtcattcacgcgctccacagtggacactatggcccagaagacccaggcagtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, C3H1-type containing
- glucosidase, beta; acid, pseudogene
- chemokine (C-X3-C motif) ligand 1
- creatine kinase, mitochondrial 1A

Buy C5AR1-complement component 5a receptor 1 Gene now

Add to cart