Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001163 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CX3CL1 |
| Origin species: | Human |
| Product name: | CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene |
| Size: | 2ug |
| Accessions: | BC001163 |
| Gene id: | 6376 |
| Gene description: | chemokine (C-X3-C motif) ligand 1 |
| Synonyms: | ABCD-3; C3Xkine; CXC3; CXC3C; NTN; NTT; SCYD1; neurotactin; C-X3-C motif chemokine 1; CX3C membrane-anchored chemokine; chemokine (C-X3-C motif) ligand 1; small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin); small inducible cytokine subfamily D (Cys-X3-Cys), member-1; small-inducible cytokine D1; C-X3-C motif chemokine ligand 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctccgatatctctgtcgtggctgctccgcttggccaccttctgccatctgactgtcctgctggctggacagcaccacggtgtgacgaaatgcaacatcacgtgcagcaagatgacatcaaagatacctgtagctttgctcatccactatcaacagaaccaggcatcatgcggcaaacgcgcaatcatcttggagacgagacagcacaggctgttctgtgccgacccgaaggagcaatgggtcaaggacgcgatgcagcatctggaccgccaggctgctgccctaactcgaaatggcggcaccttcgagaagcagatcggcgaggtgaagcccaggaccacccctgccgccgggggaatggacgagtctgtggtcctggagcccgaagccacaggcgaaagcagtagcctggagccgactccttcttcccaggaagcacagagggccctggggacctccccagagctgccgacgggcgtgactggttcctcagggaccaggctccccccgacgccaaaggctcaggatggagggcctgtgggcacggagcttttccgagtgcctcccgtctccactgccgccacgtggcagagttctgctccccaccaacctgggcccagcctctgggctgaggcaaagacctctgaggccccgtccacccaggacccctccacccaggcctccactgcgtcctccccagccccagaggagaatgctccgtctgaaggccagcgtgtgtggggtcagggacagagccccaggccagagaactctctggagcgggaggagatgggtcccgtgccagcgcacacggatgccttccaggactgggggcctggcagcatggcccacgtctctgtggtccctgtctcctcagaagggacccccagcagggagccagtggcttcaggcagctggacccctaaggctgaggaacccatccatgccaccatggacccccagaggctgggcgtccttatcactcctgtccctgacgcccaggctgccacccggaggcaggcggtggggctgctggccttccttggcctcctcttctgcctgggggtggccatgttcacctaccagagcctccagggctgccctcgaaagatggcaggagagatggcggagggccttcgctacatcccccggagctgtggtagtaattcatatgtcctggtgcccgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - creatine kinase, mitochondrial 1A - ribonuclease/angiogenin inhibitor 1 - zinc finger, BED-type containing 1 - DPH3, KTI11 homolog (S. cerevisiae) |