CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene View larger

CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001163
Product type: DNA & cDNA
Ncbi symbol: CX3CL1
Origin species: Human
Product name: CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene
Size: 2ug
Accessions: BC001163
Gene id: 6376
Gene description: chemokine (C-X3-C motif) ligand 1
Synonyms: ABCD-3; C3Xkine; CXC3; CXC3C; NTN; NTT; SCYD1; neurotactin; C-X3-C motif chemokine 1; CX3C membrane-anchored chemokine; chemokine (C-X3-C motif) ligand 1; small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin); small inducible cytokine subfamily D (Cys-X3-Cys), member-1; small-inducible cytokine D1; C-X3-C motif chemokine ligand 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctccgatatctctgtcgtggctgctccgcttggccaccttctgccatctgactgtcctgctggctggacagcaccacggtgtgacgaaatgcaacatcacgtgcagcaagatgacatcaaagatacctgtagctttgctcatccactatcaacagaaccaggcatcatgcggcaaacgcgcaatcatcttggagacgagacagcacaggctgttctgtgccgacccgaaggagcaatgggtcaaggacgcgatgcagcatctggaccgccaggctgctgccctaactcgaaatggcggcaccttcgagaagcagatcggcgaggtgaagcccaggaccacccctgccgccgggggaatggacgagtctgtggtcctggagcccgaagccacaggcgaaagcagtagcctggagccgactccttcttcccaggaagcacagagggccctggggacctccccagagctgccgacgggcgtgactggttcctcagggaccaggctccccccgacgccaaaggctcaggatggagggcctgtgggcacggagcttttccgagtgcctcccgtctccactgccgccacgtggcagagttctgctccccaccaacctgggcccagcctctgggctgaggcaaagacctctgaggccccgtccacccaggacccctccacccaggcctccactgcgtcctccccagccccagaggagaatgctccgtctgaaggccagcgtgtgtggggtcagggacagagccccaggccagagaactctctggagcgggaggagatgggtcccgtgccagcgcacacggatgccttccaggactgggggcctggcagcatggcccacgtctctgtggtccctgtctcctcagaagggacccccagcagggagccagtggcttcaggcagctggacccctaaggctgaggaacccatccatgccaccatggacccccagaggctgggcgtccttatcactcctgtccctgacgcccaggctgccacccggaggcaggcggtggggctgctggccttccttggcctcctcttctgcctgggggtggccatgttcacctaccagagcctccagggctgccctcgaaagatggcaggagagatggcggagggccttcgctacatcccccggagctgtggtagtaattcatatgtcctggtgcccgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - creatine kinase, mitochondrial 1A
- ribonuclease/angiogenin inhibitor 1
- zinc finger, BED-type containing 1
- DPH3, KTI11 homolog (S. cerevisiae)

Buy CX3CL1-chemokine (C-X3-C motif) ligand 1 Gene now

Add to cart