Login to display prices
Login to display prices
CKMT1A-creatine kinase, mitochondrial 1A Gene View larger

CKMT1A-creatine kinase, mitochondrial 1A Gene

PTXBC001926

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CKMT1A-creatine kinase, mitochondrial 1A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CKMT1A-creatine kinase, mitochondrial 1A Gene

Proteogenix catalog: PTXBC001926
Ncbi symbol: CKMT1A
Product name: CKMT1A-creatine kinase, mitochondrial 1A Gene
Size: 2ug
Accessions: BC001926
Gene id: 548596
Gene description: creatine kinase, mitochondrial 1A
Synonyms: CKMT1; U-MtCK; mia-CK; creatine kinase U-type, mitochondrial; acidic-type mitochondrial creatine kinase; creatine kinase, mitochondrial 1 (ubiquitous); ubiquitous mitochondrial creatine kinase; creatine kinase, mitochondrial 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggtcccttctcccgtctgctgtccgcccgcccgggactcaggctcctggctttggccggagcggggtctctagccgctgggtttctgctccgaccggaacctgtacgagctgccagtgaacgacggaggctgtatcccccgagcgctgagtacccagacctccgaaagcacaacaactgcatggccagtcacctgaccccagcagtctatgcacggctctgcgacaagaccacacccactggttggacgctagatcagtgtatccagactggcgtggacaaccctggccaccccttcatcaagactgtgggcatggtggctggagatgaggagacctatgaggtatttgctgacctgtttgaccctgtgatccaagagcgacacaatggatatgacccccggacaatgaagcacaccacggatctagatgccagtaaaatccgttctggctactttgatgagaggtatgtattgtcctctagagtcagaactggccgaagcatccgaggactcagtctgcctccagcttgcactcgagcagagcgacgagaggtggaacgtgttgtggtggatgcactgagtggcctgaagggtgacctggctggacgttactataggctcagtgagatgacagaggctgaacagcagcagcttattgatgaccactttctgtttgataagcctgtgtccccgttgctgactgcagcaggaatggctcgagactggccagatgctcgtggaatttggcacaacaatgagaagagcttcctgatctgggtgaatgaggaggatcatacacgggtgatctccatggagaagggtggtaacatgaagagagtgtttgaaagattctgccgaggcctcaaagaggtggagagacttatccaagaacgtggctgggagttcatgtggaatgagcgtttgggatacatcttgacctgtccatctaacctgggcactggacttcgggcaggagtgcacatcaaactgcccctgctaagcaaagatagccgcttcccaaagatcctggagaacctaagactccaaaagcgtggtactggaggagtggacactgctgccacaggcggtgtctttgatatttctaatttggaccgactaggcaaatcagaggtggagctggtgcaactggtcatcgatggagtaaactatttgattgattgtgaacggcgtctggagagaggccaggatatccgcatccccacacctgtcatccacaccaagcattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: