DPH3-DPH3, KTI11 homolog (S. cerevisiae) Gene View larger

DPH3-DPH3, KTI11 homolog (S. cerevisiae) Gene

PTXBC010181

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPH3-DPH3, KTI11 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DPH3-DPH3, KTI11 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010181
Product type: DNA & cDNA
Ncbi symbol: DPH3
Origin species: Human
Product name: DPH3-DPH3, KTI11 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC010181
Gene id: 285381
Gene description: DPH3, KTI11 homolog (S. cerevisiae)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtgtttcatgacgaggtggaaatcgaggacttccaatatgacgaggactcggagacgtatttctatccctgcccatgtggagataacttctccatcaccaaggaagatttggagaatggggaagacgtggcaacgtgtcctagctgctctctcattataaaagtgatttatgacaaagatcagtttgtgtgtggagaaacagtcccagccccttcagccaacaaagaattagttaaatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X-C motif) ligand 11
- S100 calcium binding protein A10
- chemokine (C-X-C motif) ligand 10
- S100 calcium binding protein A13

Buy DPH3-DPH3, KTI11 homolog (S. cerevisiae) Gene now

Add to cart