Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of S100A10-S100 calcium binding protein A10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about S100A10-S100 calcium binding protein A10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015973 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | S100A10 |
| Origin species: | Human |
| Product name: | S100A10-S100 calcium binding protein A10 Gene |
| Size: | 2ug |
| Accessions: | BC015973 |
| Gene id: | 6281 |
| Gene description: | S100 calcium binding protein A10 |
| Synonyms: | 42C; ANX2L; ANX2LG; CAL1L; CLP11; Ca[1]; GP11; P11; p10; protein S100-A10; S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptide (p11)); annexin II ligand, calpactin I, light polypeptide; annexin II tetramer (AIIt) p11 subunit; calpactin I light chain; calpactin-1 light chain; cellular ligand of annexin II; S100 calcium binding protein A10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccatctcaaatggaacacgccatggaaaccatgatgtttacatttcacaaattcgctggggataaaggctacttaacaaaggaggacctgagagtactcatggaaaaggagttccctggatttttggaaaatcaaaaagaccctctggctgtggacaaaataatgaaggacctggaccagtgtagagatggcaaagtgggcttccagagcttcttttccctaattgcgggcctcaccattgcatgcaatgactattttgtagtacacatgaagcagaagggaaagaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-X-C motif) ligand 10 - S100 calcium binding protein A13 - mitochondrial ribosomal protein 63 - S100 calcium binding protein A11 |