Login to display prices
Login to display prices
S100A10-S100 calcium binding protein A10 Gene View larger

S100A10-S100 calcium binding protein A10 Gene

PTXBC015973

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A10-S100 calcium binding protein A10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A10-S100 calcium binding protein A10 Gene

Proteogenix catalog: PTXBC015973
Ncbi symbol: S100A10
Product name: S100A10-S100 calcium binding protein A10 Gene
Size: 2ug
Accessions: BC015973
Gene id: 6281
Gene description: S100 calcium binding protein A10
Synonyms: 42C; ANX2L; ANX2LG; CAL1L; CLP11; Ca[1]; GP11; P11; p10; protein S100-A10; S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptide (p11)); annexin II ligand, calpactin I, light polypeptide; annexin II tetramer (AIIt) p11 subunit; calpactin I light chain; calpactin-1 light chain; cellular ligand of annexin II; S100 calcium binding protein A10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccatctcaaatggaacacgccatggaaaccatgatgtttacatttcacaaattcgctggggataaaggctacttaacaaaggaggacctgagagtactcatggaaaaggagttccctggatttttggaaaatcaaaaagaccctctggctgtggacaaaataatgaaggacctggaccagtgtagagatggcaaagtgggcttccagagcttcttttccctaattgcgggcctcaccattgcatgcaatgactattttgtagtacacatgaagcagaagggaaagaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: