ZFC3H1-zinc finger, C3H1-type containing Gene View larger

ZFC3H1-zinc finger, C3H1-type containing Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFC3H1-zinc finger, C3H1-type containing Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZFC3H1-zinc finger, C3H1-type containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015679
Product type: DNA & cDNA
Ncbi symbol: ZFC3H1
Origin species: Human
Product name: ZFC3H1-zinc finger, C3H1-type containing Gene
Size: 2ug
Accessions: BC015679
Gene id: 196441
Gene description: zinc finger, C3H1-type containing
Synonyms: CCDC131; CSRC2; PSRC2; zinc finger C3H1 domain-containing protein; coiled-coil domain containing 131; coiled-coil domain-containing protein 131; proline/serine-rich coiled-coil 2; proline/serine-rich coiled-coil protein 2; zinc finger C3H1-type containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccgcagatactccggccccggcctccagtggcctctcgccgaaggaagaaggggagcttgaagatggggaaatcagtgacgacgataataacagccagatacggagtcggagcagcagcagcagcagcggcggcgggctgttaccctatccgcggcgaaggcctcctcactcggcccggggcggtggatctggcggaggcggtggctcttcctcgtcatcgtcctcttctcagcagcagctgaggaatttctcacgctcgcggcacgcgtctgagcggggccacctcaggggacccagcagctaccgacccaaagaaccgttccggtctcatccgccttctgtacggatgccttcgagctcactgtccgaaagcagtccccggccgtctttctgggagcggagccacctcgccttggaccgtttccgctttcgaggcaggccttaccggggtgggagtcgctggagtcgggggcgaggagtgggtgagcgaggaggcaagccggggtgcagacctcctctgggaggaggagcaggatccgggttcagcagcagtcagagctggcgagagccctctccacctcggaagagctccaaaagttttggaaggtctccatcaagaaaacaaaattattcatcaaaaaatgaaaactgtgtggaagaaacttttgaagatttgcttttaaagtataaacaaatacagttggaactagaatgcatcaataaggatgaaaaactagcattgagtagcaaagaagagaatgtgcaggaagatcctaaaacattgaacttcgaggaccaaactagcactgataatgtcagtattacaaaggattcaagtaaagaagtagctcctgaggagaaaacacaagtcaaaacttttcaggcatttgaattaaaaccactcaggcaaaaattgactttaccaggagataagaaccgtttgaaaaaagttaaagatggagcaaaaccactttccctgaaatccgacactactgattctagtcaaggtatcccttatcgggtaaaggagggttttactcctattcctggtttgaaattttcagcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glucosidase, beta; acid, pseudogene
- chemokine (C-X3-C motif) ligand 1
- creatine kinase, mitochondrial 1A
- ribonuclease/angiogenin inhibitor 1

Buy ZFC3H1-zinc finger, C3H1-type containing Gene now

Add to cart