BAT2L-HLA-B associated transcript 2-like Gene View larger

BAT2L-HLA-B associated transcript 2-like Gene

PTXBC002872

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAT2L-HLA-B associated transcript 2-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAT2L-HLA-B associated transcript 2-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002872
Product type: DNA & cDNA
Ncbi symbol: BAT2L
Origin species: Human
Product name: BAT2L-HLA-B associated transcript 2-like Gene
Size: 2ug
Accessions: BC002872
Gene id: 84726
Gene description: HLA-B associated transcript 2-like
Synonyms: BAT2L; BAT2L1; KIAA0515; LQFBS-1; protein PRRC2B; HLA-B associated transcript 2-like; HLA-B-associated transcript 2-like 1; proline-rich coiled-coil protein 2B; protein BAT2-like 1; proline rich coiled-coil 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgatcgtttggggcaaattaccaagggcaaggatgggaaaagcaagtactcgactctcagcctgtttgataagtataaaggaaaatcagtagacgcgattagatcctcagttattcctagacatggcttacagagtcttgggaaagttgctgcagcccggcgcatgccaccgcctgcaaacctgccaagcttgaagtctgaaaacaaaggaaacgaccccaacatcgtgatagtacccaaggacgggacgggatgggcaaacaagcaggatcagcaagacccaaagagttccagtgcgacggcctctcagccgccggagtcgctgccgcagccgggtttgcagaaatctgtctccaatttgcagaaaccgacacagtcaatcagtcaggagaatacaaattcagtgccaggtggaccaaagtcatgggcacagctgaatggaaagccagtaggacacgaaggtggtttaaggggctcaagccgactgttatccttctctcccgaggaatttccgacgctgaaagcagctggagggcaggacaaggctggcaaagaaaagggcgtcttagatctgtcgtatgggccaggaccaagcctccgccctcagaatgtgacaagctggagggagggcggtgggcgacacataatttctgccacgtctctgagcacctccccaactgagctgggcagcaggaactcgagtacgggagatggagccccctcctcggcatgtaccagcgattctaaggacccctctctccgcccggctcagcctgtccgaaaaggggcttcacagttcatgggaaatgtataccacccacctacataccatgacatgcttcctgcttttatgtgttcgccgaagtcatcagaaaaccagggtacagtggaacgaggctcttttccccttcctcagctccgccttgaacctcgagttccttttagacagttccagatgaatgaccaagactggaattatggtgctagattagtaaacatgacttttaatgagt
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein L3
- complement component 5a receptor 1
- zinc finger, C3H1-type containing
- glucosidase, beta; acid, pseudogene

Buy BAT2L-HLA-B associated transcript 2-like Gene now

Add to cart