No products
Prices are tax excluded
PTXBC003513
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003513 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL14 |
| Origin species: | Human |
| Product name: | CXCL14-chemokine (C-X-C motif) ligand 14 Gene |
| Size: | 2ug |
| Accessions: | BC003513 |
| Gene id: | 9547 |
| Gene description: | chemokine (C-X-C motif) ligand 14 |
| Synonyms: | BMAC; KEC; KS1; MIP-2g; MIP2G; NJAC; SCYB14; C-X-C motif chemokine 14; CXC chemokine in breast and kidney; MIP-2 gamma; bolekine; breast and kidney; chemokine (C-X-C motif) ligand 14; chemokine BRAK; small inducible cytokine subfamily B (Cys-X-Cys), member 14 (BRAK); small-inducible cytokine B14; tumor-suppressing chemokine; C-X-C motif chemokine ligand 14 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccctgctcccacgccgcgcccctccggtcagcatgaggctcctggcggccgcgctgctcctgctgctgctggcgctgtacaccgcgcgtgtggacgggtccaaatgcaagtgctcccggaagggacccaagatccgctacagcgacgtgaagaagctggaaatgaagccaaagtacccgcactgcgaggagaagatggttatcatcaccaccaagagcgtgtccaggtaccgaggtcaggagcactgcctgcaccccaagctgcagagcaccaagcgcttcatcaagtggtacaacgcctggaacgagaagcgcagggtctacgaagaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 20 - cancer/testis antigen CT45-3 - fetal and adult testis expressed 1 - musculin (activated B-cell factor-1) |