No products
Prices are tax excluded
PTXBC022064
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC022064 |
Product type: | DNA & cDNA |
Ncbi symbol: | FATE1 |
Origin species: | Human |
Product name: | FATE1-fetal and adult testis expressed 1 Gene |
Size: | 2ug |
Accessions: | BC022064 |
Gene id: | 89885 |
Gene description: | fetal and adult testis expressed 1 |
Synonyms: | CT43; fetal and adult testis-expressed transcript protein; BJ-HCC-2 antigen; cancer/testis antigen 43; tumor antigen BJ-HCC-2; fetal and adult testis expressed 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcaggaggccctcccaacaccaaggcggagatggaaatgtccctggcagaagaactgaatcatggacgccaaggggaaaaccaagagcacctggtgatagcagaaatgatggagcttggatctcggtcccggggtgcctcccagaagaagcagaagttggaacaaaaagctgctggctctgcttcagccaaacgagtttggaatatgactgccacccgacccaagaaaatggggtcccagctgccaaagcccagaatgctgagagaatcaggccatggggatgcccatctccaggagtacgctggcaatttccaaggcatacgtttccattatgatcgcaacccagggacagatgcagtggcgcagactagcctggaagagttcaatgtactggagatggaagtcatgagaagacagctgtatgcagtcaaccggcgtctgcgcgccctggaggaacagggcgccacctggcgccacagggagaccctgatcatcgccgtgctggtgtcggccagcattgccaacctgtggctgtggatgaaccagtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - musculin (activated B-cell factor-1) - CHK2 checkpoint homolog (S. pombe) - mitogen-activated protein kinase 7 - rhomboid 5 homolog 2 (Drosophila) |