Cart 1 Product Products 121,50 € (empty)
-
1 x ZAP70-zeta...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
Data sheet of LRRC20-leucine rich repeat containing 20 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRRC20-leucine rich repeat containing 20 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024001 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRRC20 |
| Origin species: | Human |
| Product name: | LRRC20-leucine rich repeat containing 20 Gene |
| Size: | 2ug |
| Accessions: | BC024001 |
| Gene id: | 55222 |
| Gene description: | leucine rich repeat containing 20 |
| Synonyms: | leucine-rich repeat-containing protein 20; leucine rich repeat containing 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaagaagatgggtgaggccgtggccagagtagcaaggaaggtcaacgagacggtggagagcggctctgacactctggacctggccgagtgcaagctggtctcctttcccattggcatctacaaggtcctgcggaatgtctctggccagatccacctcatcaccctggctaacaatgagcttaagtccctcaccagcaagttcatgaccacattcagtcagctccgagagctccacctggaggggaacttcctacaccgcctccccagcgaggtcagtgccctgcagcacctcaaggccattgacctgtcccggaaccagttccaggacttccctgagcagcttaccgccctgccggcgctggagaccatcaacctggaggagaacgagatcgtagatgtgcccgtggagaagctggccgccatgccagccttgcgcagcatcaacctccgcttcaacccactcaacgccgaggtgcgcgtgatcgccccgccgctcatcaagtttgacatgctcatgtctccggaaggcgcaagagcccccctaccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cancer/testis antigen CT45-3 - fetal and adult testis expressed 1 - musculin (activated B-cell factor-1) - CHK2 checkpoint homolog (S. pombe) |