Cart 8 Product Products 879,98 € (empty)
-
1 x AKT1S1-AKT...113,40 € -
1 x EML2-echin...121,50 € -
-
-
1 x CANT1-calc...121,50 € -
1 x NDUFB11-NA...113,40 € -
-
No products
To be determined Shipping
879,98 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 879,98 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 879,98 €
Data sheet of RP13-36C9.3-cancer/testis antigen CT45-3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RP13-36C9.3-cancer/testis antigen CT45-3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028711 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RP13-36C9.3 |
| Origin species: | Human |
| Product name: | RP13-36C9.3-cancer/testis antigen CT45-3 Gene |
| Size: | 2ug |
| Accessions: | BC028711 |
| Gene id: | 441519 |
| Gene description: | cancer/testis antigen CT45-3 |
| Synonyms: | CT45-3; CT45-4; CT45.3; CT45.4; CT45A4; cancer/testis antigen family 45 member A3; cancer/testis antigen 45-3; cancer/testis antigen 45-4; cancer/testis antigen 45A3; cancer/testis antigen 45A4; cancer/testis antigen CT45-3; cancer/testis antigen family 45 member A4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccgataaaacagagaaggtggctgtagatcctgaaactgtgtttaaacgtcccagggaatgtgacagtccttcgtatcagaaaaggcagaggatggccctgttggcaaggaaacaaggagcaggagacagccttattgcaggctctgccatgtccaaagaaaagaagcttatgacaggacatgctattccacccagccaattggattctcagattgatgacttcactggtttcagcaaagataggatgatgcagaaacctggtagcaatgcacctgtgggaggaaacgttaccagcagtttctctggagatgacctagaatgcagagaaacagcctcctctcccaaaagccaacgagaaattaatgctgatataaaacgtaaattagtgaaggaactccgatgcgttggacaaaaatatgaaaaaatcttcgaaatgcttgaaggagtgcaaggacctactgcagtcaggaagcgattttttgaatccatcatcaaggaagcagcaagatgtatgagacgagactttgttaagcaccttaagaagaaactgaaacgtatgatttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fetal and adult testis expressed 1 - musculin (activated B-cell factor-1) - CHK2 checkpoint homolog (S. pombe) - mitogen-activated protein kinase 7 |