TIMP1-TIMP metallopeptidase inhibitor 1 Gene View larger

TIMP1-TIMP metallopeptidase inhibitor 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMP1-TIMP metallopeptidase inhibitor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TIMP1-TIMP metallopeptidase inhibitor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000866
Product type: DNA & cDNA
Ncbi symbol: TIMP1
Origin species: Human
Product name: TIMP1-TIMP metallopeptidase inhibitor 1 Gene
Size: 2ug
Accessions: BC000866
Gene id: 7076
Gene description: TIMP metallopeptidase inhibitor 1
Synonyms: CLGI; EPA; EPO; HCI; TIMP; metalloproteinase inhibitor 1; collagenase inhibitor; erythroid potentiating activity; fibroblast collagenase inhibitor; tissue inhibitor of metalloproteinases 1; TIMP metallopeptidase inhibitor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccccctttgagcccctggcttctggcatcctgttgttgctgtggctgatagcccccagcagggcctgcacctgtgtcccaccccacccacagacggccttctgcaattccgacctcgtcatcagggccaagttcgtggggacaccagaagtcaaccagaccaccttataccagcgttatgagatcaagatgaccaagatgtataaagggttccaagccttaggggatgccgctgacatccggttcgtctacacccccgccatggagagtgtctgcggatacttccacaggtcccacaaccgcagcgaggagtttctcattgctggaaaactgcaggatggactcttgcacatcactacctgcagtttcgtggctccctggaacagcctgagcttagctcagcgccggggcttcaccaagacctacactgttggctgtgaggaatgcacagtgtttccctgtttatccatcccctgcaaactgcagagtggcactcattgcttgtggacggaccagctcctccaaggctctgaaaagggcttccagtcccgtcaccttgcctgcctgcctcgggagccagggctgtgcacctggcagtccctgcggtcccagatagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB38, member RAS oncogene family
- RAB2A, member RAS oncogene family
- RAB39, member RAS oncogene family
- RAB4A, member RAS oncogene family

Buy TIMP1-TIMP metallopeptidase inhibitor 1 Gene now

Add to cart