Login to display prices
Login to display prices
RAB2A-RAB2A, member RAS oncogene family Gene View larger

RAB2A-RAB2A, member RAS oncogene family Gene

PTXBC008929

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB2A-RAB2A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB2A-RAB2A, member RAS oncogene family Gene

Proteogenix catalog: PTXBC008929
Ncbi symbol: RAB2A
Product name: RAB2A-RAB2A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC008929
Gene id: 5862
Gene description: RAB2A, member RAS oncogene family
Synonyms: RAB2A, member RAS oncogene family; small GTP binding protein RAB2A; LHX; RAB2; ras-related protein Rab-2A; RAB2, member RAS oncogene family
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtacgcctatctcttcaagtacatcataatcggcgacacaggtgttggtaaatcatgcttattgctacagtttacagacaagaggtttcagccagtgcatgaccttactattggtgtagagttcggtgctcgaatgataactattgatgggaaacagataaaacttcagatatgggatacggcagggcaagaatcctttcgttccatcacaaggtcgtattacagaggtgcagcaggagctttactagtttacgatattacacggagagatacattcaaccacttgacaacctggttagaagatgcccgccagcattccaattccaacatggtcattatgcttattggaaataaaagtgatttagaatctagaagagaagtaaaaaaagaagaaggtgaagcttttgcacgagaacatggactcatcttcatggaaacgtctgctaagactgcttccaatgtagaagaggcatttattaatacagcaaaagaaatttatgaaaaaattcaagaaggagtctttgacattaataatgaggcaaatggcattaaaattggccctcagcatgctgctaccaatgcaacacatgcaggcaatcagggaggacagcaggctgggggcggctgctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice