Login to display prices
Login to display prices
RAB3A-RAB3A, member RAS oncogene family Gene View larger

RAB3A-RAB3A, member RAS oncogene family Gene

PTXBC011782

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB3A-RAB3A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB3A-RAB3A, member RAS oncogene family Gene

Proteogenix catalog: PTXBC011782
Ncbi symbol: RAB3A
Product name: RAB3A-RAB3A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC011782
Gene id: 5864
Gene description: RAB3A, member RAS oncogene family
Synonyms: RAB3A, member RAS oncogene family; RAS-associated protein RAB3A; ras-related protein Rab-3A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatccgccacagactcgcgctatgggcagaaggagtcctcggatcagaacttcgactacatgttcaagattctcatcatcggcaacagcagcgtgggcaagacgtccttcctcttccgctatgctgacgactcgttcacgcctgccttcgtcagcaccgtgggcatcgacttcaaggtcaagaccatctatcgcaacgacaagaggatcaagctgcagatctgggacacagcagggcaagagcggtaccggaccatcaccaccgcatactaccggggcgctatgggcttcatcctcatgtatgacatcaccaacgaggaatccttcaatgcagtgcaggactggtccacccagatcaagacctactcatgggacaatgcccaggtgctgctggtaggaaacaagtgtgacatggaggatgagcgggtggtgtcatcagaacgtggccggcagctagctgaccaccttgggttcgagttctttgaggcaagcgccaaggacaacattaacgtcaagcagacctttgagcgcctggtggatgtcatctgcgagaagatgtccgagtcgttggacacggcggaccctgcggtcacaggcgccaagcagggcccacagctcagtgaccagcaggtgccaccgcaccaggactgcgcctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: