RAB4A-RAB4A, member RAS oncogene family Gene View larger

RAB4A-RAB4A, member RAS oncogene family Gene

PTXBC002438

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB4A-RAB4A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB4A-RAB4A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002438
Product type: DNA & cDNA
Ncbi symbol: RAB4A
Origin species: Human
Product name: RAB4A-RAB4A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC002438
Gene id: 5867
Gene description: RAB4A, member RAS oncogene family
Synonyms: RAB4A, member RAS oncogene family; HRES-1; HRES-1/RAB4; HRES1; RAB4; ras-related protein Rab-4A; HTLV-1 related endogenous sequence
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcagacggccatgtccgaaacctacgattttttgtttaagttcttggttattggaaatgcaggaactggcaaatcttgcttacttcatcagtttattgaaaaaaaattcaaagatgactcaaatcatacaataggagtggaatttggttcaaagataataaatgttggtggtaaatatgtaaagttacaaatatgggatacagcaggacaagaacgattcaggtccgtgacgagaagttattaccgaggcgcggccggggctctcctcgtctatgatatcaccagccgagaaacctacaatgcgcttactaattggttaacagatgcccgaatgctagcgagccagaacattgtgatcatcctttgtggaaacaagaaggacctggatgcagatcgtgaagttaccttcttagaagcctccagatttgctcaagaaaatgagctgatgtttttggaaacaagtgcgctcacaggggagaatgtagaagaggcttttgtacagtgtgcaagaaaaatacttaacaaaatcgaatcaggtgagctggacccagaaagaatgggctcaggtattcagtacggagatgctgccttgagacagctgaggtcaccgcggcgcgcacaggccccgaacgctcaggagtgtggttgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB3A, member RAS oncogene family
- glutathione S-transferase alpha 2
- Kruppel-like factor 7 (ubiquitous)
- RAB23, member RAS oncogene family

Buy RAB4A-RAB4A, member RAS oncogene family Gene now

Add to cart