RAB39-RAB39, member RAS oncogene family Gene View larger

RAB39-RAB39, member RAS oncogene family Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB39-RAB39, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB39-RAB39, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028064
Product type: DNA & cDNA
Ncbi symbol: RAB39
Origin species: Human
Product name: RAB39-RAB39, member RAS oncogene family Gene
Size: 2ug
Accessions: BC028064
Gene id: 54734
Gene description: RAB39, member RAS oncogene family
Synonyms: RAB39, member RAS oncogene family; RAB39; ras-related protein Rab-39A; rab-39; rab-related GTP-binding protein; RAB39A, member RAS oncogene family
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaccatctggatctaccagttccgcctcatcgtgatcggggactccaccgtgggcaagtcctgcctcctgcaccgcttcacccagggccgcttccccgggctgcgctcccccgcctgcgaccccaccgtcggcgtggacttcttctcccgcctgctggagatcgagccgggcaagaggatcaagctacagctctgggacacggcgggacaggagcggttcagatcaataacccgatcttattaccgcaactcagttggtggatttttagtatttgacattactaaccgacgatcttttgaacatgtgaaagattggctagaagaagcaaaaatgtatgtacagccatttcggattgtatttctgctagtgggacataaatgtgatttagcttcacaacgtcaagttacaagggaagaagctgaaaaactgtcagcagactgtggaatgaagtatatagaaacctcagcaaaggatgctacaaatgttgaagaatccttcacaatcttgacgagagacatatatgaacttattaaaaagggagaaatttgtattcaggatggctgggaaggggttaaaagtggttttgttccaaatactgtgcattcttctgaggaagcagtaaagcccaggaaagaatgcttctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB4A, member RAS oncogene family
- RAB3A, member RAS oncogene family
- glutathione S-transferase alpha 2
- Kruppel-like factor 7 (ubiquitous)

Buy RAB39-RAB39, member RAS oncogene family Gene now

Add to cart