RAB38-RAB38, member RAS oncogene family Gene View larger

RAB38-RAB38, member RAS oncogene family Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB38-RAB38, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB38-RAB38, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015808
Product type: DNA & cDNA
Ncbi symbol: RAB38
Origin species: Human
Product name: RAB38-RAB38, member RAS oncogene family Gene
Size: 2ug
Accessions: BC015808
Gene id: 23682
Gene description: RAB38, member RAS oncogene family
Synonyms: RAB38, member RAS oncogene family; NY-MEL-1; rrGTPbp; ras-related protein Rab-38; Rab-related GTP-binding protein; melanoma antigen NY-MEL-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggccccgcacaaggagcacctgtacaagttgctggtgattggcgacctgggcgtggggaagaccagtatcatcaagcgctacgtgcaccagaacttctcctcgcactaccgggccacaatcggcgtggacttcgcgctcaaggtgctccactgggacccggagactgtggtgcgcctgcagctctgggatatcgcaggtcaagaaagatttggaaacatgacgagggtctattaccgagaagctatgggtgcatttattgtcttcgatgtcaccaggccagccacatttgaagcagtggcaaagtggaaaaatgatttggactccaagttaagtctccctaatggcaaaccggtttcagtggttttgttggccaacaaatgtgaccaggggaaggatgtgctcatgaacaatggcctcaagatggaccagttctgcaaggagcacggtttcgtaggatggtttgaaacatcagcaaaggaaaatataaacattgatgaagcctccagatgcctggtgaaacacatacttgcaaatgagtgtgacctaatggagtctattgagccggacgtcgtgaagccccatctcacatcaaccaaggttgccagctgctctggctgtgccaaatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB2A, member RAS oncogene family
- RAB39, member RAS oncogene family
- RAB4A, member RAS oncogene family
- RAB3A, member RAS oncogene family

Buy RAB38-RAB38, member RAS oncogene family Gene now

Add to cart