Login to display prices
Login to display prices
RAB38-RAB38, member RAS oncogene family Gene View larger

RAB38-RAB38, member RAS oncogene family Gene

PTXBC015808

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB38-RAB38, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB38-RAB38, member RAS oncogene family Gene

Proteogenix catalog: PTXBC015808
Ncbi symbol: RAB38
Product name: RAB38-RAB38, member RAS oncogene family Gene
Size: 2ug
Accessions: BC015808
Gene id: 23682
Gene description: RAB38, member RAS oncogene family
Synonyms: RAB38, member RAS oncogene family; NY-MEL-1; rrGTPbp; ras-related protein Rab-38; Rab-related GTP-binding protein; melanoma antigen NY-MEL-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggccccgcacaaggagcacctgtacaagttgctggtgattggcgacctgggcgtggggaagaccagtatcatcaagcgctacgtgcaccagaacttctcctcgcactaccgggccacaatcggcgtggacttcgcgctcaaggtgctccactgggacccggagactgtggtgcgcctgcagctctgggatatcgcaggtcaagaaagatttggaaacatgacgagggtctattaccgagaagctatgggtgcatttattgtcttcgatgtcaccaggccagccacatttgaagcagtggcaaagtggaaaaatgatttggactccaagttaagtctccctaatggcaaaccggtttcagtggttttgttggccaacaaatgtgaccaggggaaggatgtgctcatgaacaatggcctcaagatggaccagttctgcaaggagcacggtttcgtaggatggtttgaaacatcagcaaaggaaaatataaacattgatgaagcctccagatgcctggtgaaacacatacttgcaaatgagtgtgacctaatggagtctattgagccggacgtcgtgaagccccatctcacatcaaccaaggttgccagctgctctggctgtgccaaatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: