RAB18-RAB18, member RAS oncogene family Gene View larger

RAB18-RAB18, member RAS oncogene family Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB18-RAB18, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB18-RAB18, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015014
Product type: DNA & cDNA
Ncbi symbol: RAB18
Origin species: Human
Product name: RAB18-RAB18, member RAS oncogene family Gene
Size: 2ug
Accessions: BC015014
Gene id: 22931
Gene description: RAB18, member RAS oncogene family
Synonyms: RAB18, member RAS oncogene family; RAB18 small GTPase; RAB18LI1; WARBM3; ras-related protein Rab-18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgaggacgtgctaaccaccctgaagatcctcatcatcggcgagagtggggtgggcaagtccagcctgctcttgaggttcacagatgatacgtttgatccagaacttgcagcaacaataggtgttgactttaaggtgaaaacaatttcagtggatggaaataaggctaaacttgcaatatgggatactgctggtcaagagaggtttagaacattaactcccagctattatagaggtgcacagggtgttatattagtttatgatgtcacaagaagagatacatttgttaaactggataattggttaaatgaattggaaacatactgtacaagaaatgacatagtaaacatgctagttggaaataaaatcgataaggaaaatcgtgaagtcgatagaaatgaaggcctgaaatttgcacgaaagcattccatgttatttatagaggcaagtgcaaaaacctgtgatggtgtacaatgtgcctttgaagaacttgttgaaaagatcattcagacccctggactgtgggaaagtgagaaccagaataaaggagtcaaactgtcacacagggaagaaggccaaggaggaggagcctgtggtggttattgctctgtgttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TIMP metallopeptidase inhibitor 1
- RAB38, member RAS oncogene family
- RAB2A, member RAS oncogene family
- RAB39, member RAS oncogene family

Buy RAB18-RAB18, member RAS oncogene family Gene now

Add to cart