PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene View larger

PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011396
Product type: DNA & cDNA
Ncbi symbol: PUS7
Origin species: Human
Product name: PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011396
Gene id: 54517
Gene description: pseudouridylate synthase 7 homolog (S. cerevisiae)
Synonyms: pseudouridylate synthase 7 homolog; pseudouridylate synthase 7 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaatatagtctctgcatttggcataatacccagaaataatcgcttaatgtatattcatagctaccaaagctatgtgtggaataacatggtaagcaagaggatagaagactatggactaaaacctgttccaggggacctcgttctcaaaggagccacagccacctatattgaggaagatgatgttaataattactctatccatgatgtggtaatgcccttgcctggtttcgatgttatctacccaaagcataaaattcaagaagcctacagggaaatgctcacagctgacaatcttgatattgacaacatgagacacaaaattcgagattattccttgtcaggggcctaccgaaagatcattattcgtcctcagaatgttagctgggaagtcgttgcatatgatgatcccaaaattccacttttcaacacagatgtggacaacctagaagggaagacaccaccagtttttgcttctgaaggcaaatacagggctctgaaaatggatttttctctacccccttctacttacgccaccatggccattcgagaagtgctaaaaatggataccagtatcaagaaccagacgcagctgaatacaacctggcttcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromobox homolog 2 (Pc class homolog, Drosophila)
- family with sequence similarity 177, member A1
- carboxymethylenebutenolidase homolog (Pseudomonas)
- phosphoinositide-3-kinase interacting protein 1

Buy PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene now

Add to cart