Login to display prices
Login to display prices
PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene View larger

PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene

PTXBC011396

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC011396
Ncbi symbol: PUS7
Product name: PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011396
Gene id: 54517
Gene description: pseudouridylate synthase 7 homolog (S. cerevisiae)
Synonyms: pseudouridylate synthase 7 homolog; pseudouridylate synthase 7 (putative)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaatatagtctctgcatttggcataatacccagaaataatcgcttaatgtatattcatagctaccaaagctatgtgtggaataacatggtaagcaagaggatagaagactatggactaaaacctgttccaggggacctcgttctcaaaggagccacagccacctatattgaggaagatgatgttaataattactctatccatgatgtggtaatgcccttgcctggtttcgatgttatctacccaaagcataaaattcaagaagcctacagggaaatgctcacagctgacaatcttgatattgacaacatgagacacaaaattcgagattattccttgtcaggggcctaccgaaagatcattattcgtcctcagaatgttagctgggaagtcgttgcatatgatgatcccaaaattccacttttcaacacagatgtggacaacctagaagggaagacaccaccagtttttgcttctgaaggcaaatacagggctctgaaaatggatttttctctacccccttctacttacgccaccatggccattcgagaagtgctaaaaatggataccagtatcaagaaccagacgcagctgaatacaacctggcttcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: