FAM177A1-family with sequence similarity 177, member A1 Gene View larger

FAM177A1-family with sequence similarity 177, member A1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM177A1-family with sequence similarity 177, member A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM177A1-family with sequence similarity 177, member A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029559
Product type: DNA & cDNA
Ncbi symbol: FAM177A1
Origin species: Human
Product name: FAM177A1-family with sequence similarity 177, member A1 Gene
Size: 2ug
Accessions: BC029559
Gene id: 283635
Gene description: family with sequence similarity 177, member A1
Synonyms: protein FAM177A1; C14orf24; family with sequence similarity 177 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccaggagccagtgggcggtgtggaacgaggagaagccgtcgcagcctcgggagctgcggccgccgcggcattcggggaatctgcagggcagatgagtaacgaaagaggctttgaaaatgtagaactgggagtcataggaaaaaagaagaaagtcccaaggagagtcatccactttgttagtggtgaaacaatggaagaatatagcacagatgaagacgaagttgatggcctggagaagaaagatgttttgcctactgttgatccgacaaaacttacctggggtccctacttatggttttacatgcttcgggctgctacatcaactctctcagtgtgtgacttccttggagagaagattgcatctgttttgggtatcagcaccccaaagtaccaatatgccattgatgaatattatcggatgaagaaggaggaagaagaagaagaagaagaaaacaggatgtctgaagaagcagaaaaacaatatcaacagaataaattgcagactgattccattgttcagacagatcaaccagagacagtgatatccagctcatttgtgaatgtcaattttgaaatggagggagacagtgaagtaattatggaaagcaagcaaaatccagtctctgtcccaccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carboxymethylenebutenolidase homolog (Pseudomonas)
- phosphoinositide-3-kinase interacting protein 1
- C1q and tumor necrosis factor related protein 6
- Yip1 interacting factor homolog A (S. cerevisiae)

Buy FAM177A1-family with sequence similarity 177, member A1 Gene now

Add to cart