Cart 6 Product Products 1 145,31 € (empty)
-
1 x GPR171-G...121,50 € -
1 x FAM168A-fa...113,40 € -
-
1 x FAM136A-fa...113,40 € -
1 x FAM150A-fa...113,40 € -
1 x EEF1G-euka...121,50 €
No products
To be determined Shipping
1 145,31 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 145,31 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 145,31 €
View larger 
CMBL-carboxymethylenebutenolidase homolog (Pseudomonas) Gene
PTXBC001573
New product
Data sheet of CMBL-carboxymethylenebutenolidase homolog (Pseudomonas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMBL-carboxymethylenebutenolidase homolog (Pseudomonas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001573 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMBL |
| Origin species: | Human |
| Product name: | CMBL-carboxymethylenebutenolidase homolog (Pseudomonas) Gene |
| Size: | 2ug |
| Accessions: | BC001573 |
| Gene id: | 134147 |
| Gene description: | carboxymethylenebutenolidase homolog (Pseudomonas) |
| Synonyms: | JS-1; carboxymethylenebutenolidase homolog; carboxymethylenebutenolidase homolog (Pseudomonas); carboxymethylenebutenolidase-like (Pseudomonas) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaacgaagcttatccttgtccgtgtgacattggccacagacttgagtatggagggctaggccgtgaagttcaagtcgagcacatcaaggcttatgtcaccaaatcccccgttgatgcaggcaaagctgtgattgtcattcaagatatatttggctggcagttgcccaataccagatatatagctgacatgatctcaggaaatggatacacaaccattgttccagacttctttgtagggcaagagccttgggacccctctggcgactggtctatcttccctgagtggctgaaaacaagaaatgcccagaagatcgatagagagatcagtgctatcttgaagtatctgaaacaacagtgtcatgcccagaaaattggcatcgtgggattctgctggggtggaactgctgtccatcatttgatgatgaaatactcagaattcagggcaggggtgtccgtctatggcattgtcaaggattctgaagacatttacaatttaaagaaccccactttgttcatttttgctgaaaatgatgttgtgattccactcaaggacgtatctttgctgactcagaagttgaaagaacactgcaaagttgaatatcaaattaaaacattttctgggcagactcatgggttcgtgcatcggaagagagaagattgctcacctgcagacaagccctacattgacgaggccagaaggaatttaattgagtggctgaacaagtacatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoinositide-3-kinase interacting protein 1 - C1q and tumor necrosis factor related protein 6 - Yip1 interacting factor homolog A (S. cerevisiae) - SCO cytochrome oxidase deficient homolog 1 (yeast) |