CBX2-chromobox homolog 2 (Pc class homolog, Drosophila) Gene View larger

CBX2-chromobox homolog 2 (Pc class homolog, Drosophila) Gene

PTXBC004252

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBX2-chromobox homolog 2 (Pc class homolog, Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CBX2-chromobox homolog 2 (Pc class homolog, Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004252
Product type: DNA & cDNA
Ncbi symbol: CBX2
Origin species: Human
Product name: CBX2-chromobox homolog 2 (Pc class homolog, Drosophila) Gene
Size: 2ug
Accessions: BC004252
Gene id: 84733
Gene description: chromobox homolog 2 (Pc class homolog, Drosophila)
Synonyms: CDCA6; M33; SRXY5; chromobox protein homolog 2; Pc class homolog; cell division cycle associated 6; chromobox homolog 2 (Pc class homolog, Drosophila); modifier 3; chromobox 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagctgagcagcgtgggcgagcaggtcttcgccgccgagtgcatcctgagcaagcggctccgcaagggcaagctggagtacctggtcaagtggcgcggctggtcctccaaacataacagctgggagccggaggagaacatcctggacccgaggctgctcctggccttccagaagaaggaacatgagaaggaggtgcagaaccggaagagaggcaagaggccgagaggccggccaaggaagctcactgccatgtcctcctgcagccggcgctccaagctcaaggtgggtggctgcgctgggtatgctgaccccacctcccagcacccccttggcgtagggggcaggcagagggagggtttggggccctcaggaagggggtggcacttctgccaacagtctgtccctctactcggaaaacaggagccccctttcttcctgtctctcagcttctgctgccaggggccccagccggctgagagttcctccccgcccctcccaggggcttcctgcttcagcctgtcctgcacgcctctctgctgggtggcagggtcaaactgctgcagacaagcactcttccctcccagggggtccttgggggacggaaaggaacaggaagcatgcgtacagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 177, member A1
- carboxymethylenebutenolidase homolog (Pseudomonas)
- phosphoinositide-3-kinase interacting protein 1
- C1q and tumor necrosis factor related protein 6

Buy CBX2-chromobox homolog 2 (Pc class homolog, Drosophila) Gene now

Add to cart