VSTM2L-V-set and transmembrane domain containing 2 like Gene View larger

VSTM2L-V-set and transmembrane domain containing 2 like Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VSTM2L-V-set and transmembrane domain containing 2 like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VSTM2L-V-set and transmembrane domain containing 2 like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033818
Product type: DNA & cDNA
Ncbi symbol: VSTM2L
Origin species: Human
Product name: VSTM2L-V-set and transmembrane domain containing 2 like Gene
Size: 2ug
Accessions: BC033818
Gene id: 128434
Gene description: V-set and transmembrane domain containing 2 like
Synonyms: C20orf102; dJ1118M15.2; V-set and transmembrane domain-containing protein 2-like protein; V-set and transmembrane domain containing 2 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggccccgctcgccgtagcgctgggcgccctccactacctggcacttttcctgcaactcggcggcgccacgcggcccgccggccacgcgccctgggacaaccacgtctccggccacgccctgttcacagagacaccccatgacatgacagcacggacgggcgaggacgtggagatggcctgctccttccgcggcagcggctccccctcctactcgctggagatccagtggtggtatgtacggagccaccgggactggaccgacaagcaggcgtgggcctcgaaccagctaaaagcatctcagcaggaagacgcagggaaggaggcaaccaaaataagtgtggtcaaggtggtgggcagcaacatctcccacaagctgcgcctgtcccgggtgaagcccacggacgaaggttcctacgagtgccgcgtcatcgacttcagcgacggcaaggcccggcaccacaaggtcaaggcctacctgcgggtgcagccaggggagaactccgtcctgcatctgcccgaagcccctcccgccgcgcccgccccgccgccccccaagccaggcaaggagctgaggaagcgctcggtggaccaggaggcctgcagcctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pseudouridylate synthase 7 homolog (S. cerevisiae)
- chromobox homolog 2 (Pc class homolog, Drosophila)
- family with sequence similarity 177, member A1
- carboxymethylenebutenolidase homolog (Pseudomonas)

Buy VSTM2L-V-set and transmembrane domain containing 2 like Gene now

Add to cart