PTXBC033818
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033818 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VSTM2L |
| Origin species: | Human |
| Product name: | VSTM2L-V-set and transmembrane domain containing 2 like Gene |
| Size: | 2ug |
| Accessions: | BC033818 |
| Gene id: | 128434 |
| Gene description: | V-set and transmembrane domain containing 2 like |
| Synonyms: | C20orf102; dJ1118M15.2; V-set and transmembrane domain-containing protein 2-like protein; V-set and transmembrane domain containing 2 like |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggccccgctcgccgtagcgctgggcgccctccactacctggcacttttcctgcaactcggcggcgccacgcggcccgccggccacgcgccctgggacaaccacgtctccggccacgccctgttcacagagacaccccatgacatgacagcacggacgggcgaggacgtggagatggcctgctccttccgcggcagcggctccccctcctactcgctggagatccagtggtggtatgtacggagccaccgggactggaccgacaagcaggcgtgggcctcgaaccagctaaaagcatctcagcaggaagacgcagggaaggaggcaaccaaaataagtgtggtcaaggtggtgggcagcaacatctcccacaagctgcgcctgtcccgggtgaagcccacggacgaaggttcctacgagtgccgcgtcatcgacttcagcgacggcaaggcccggcaccacaaggtcaaggcctacctgcgggtgcagccaggggagaactccgtcctgcatctgcccgaagcccctcccgccgcgcccgccccgccgccccccaagccaggcaaggagctgaggaagcgctcggtggaccaggaggcctgcagcctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - pseudouridylate synthase 7 homolog (S. cerevisiae) - chromobox homolog 2 (Pc class homolog, Drosophila) - family with sequence similarity 177, member A1 - carboxymethylenebutenolidase homolog (Pseudomonas) |