Login to display prices
Login to display prices
IFFO1-intermediate filament family orphan 1 Gene View larger

IFFO1-intermediate filament family orphan 1 Gene

PTXBC004384

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFFO1-intermediate filament family orphan 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFFO1-intermediate filament family orphan 1 Gene

Proteogenix catalog: PTXBC004384
Ncbi symbol: IFFO1
Product name: IFFO1-intermediate filament family orphan 1 Gene
Size: 2ug
Accessions: BC004384
Gene id: 25900
Gene description: intermediate filament family orphan 1
Synonyms: HOM-TES-103; IFFO; intermediate filament family orphan 1; intermediate filament-like MGC:2625
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggggcggaagcgggagcgcaaggctgccgtcgaggaggacacctccctgtcggagagtgaggggccccgccagcccgatggggatgaggaggagagcacagccctcagcatcaacgaggagatgcagcgcatgctcaaccagctgagggagtatgattttgaggacgactgtgacagcctgacttgggaggagactgaggagaccctgctgctttgggaggatttctcaggctatgccatggcagctgcagaggcccagggagagcagcaggaagatagcctggagaaggtgattaaagatacggagtccctgttcaaaacccgggagaaggagtatcaggagaccattgaccagatagagctggagttggccacggccaagaacgacatgaaccggcacctgcacgagtacatggagatgtgcagcatgaagcgcggcctggacgtgcagatggagacctgccgccggctcatcacccagtctggagaccgaaagtctcctgctttcactgcggtcccgcttagcgacccgccgccgccgccaagcgaggctgaggactccgatcgcgatgtctcatctgacagctccatgagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice