IFFO1-intermediate filament family orphan 1 Gene View larger

IFFO1-intermediate filament family orphan 1 Gene

PTXBC004384

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFFO1-intermediate filament family orphan 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFFO1-intermediate filament family orphan 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004384
Product type: DNA & cDNA
Ncbi symbol: IFFO1
Origin species: Human
Product name: IFFO1-intermediate filament family orphan 1 Gene
Size: 2ug
Accessions: BC004384
Gene id: 25900
Gene description: intermediate filament family orphan 1
Synonyms: HOM-TES-103; IFFO; intermediate filament family orphan 1; intermediate filament-like MGC:2625
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggggcggaagcgggagcgcaaggctgccgtcgaggaggacacctccctgtcggagagtgaggggccccgccagcccgatggggatgaggaggagagcacagccctcagcatcaacgaggagatgcagcgcatgctcaaccagctgagggagtatgattttgaggacgactgtgacagcctgacttgggaggagactgaggagaccctgctgctttgggaggatttctcaggctatgccatggcagctgcagaggcccagggagagcagcaggaagatagcctggagaaggtgattaaagatacggagtccctgttcaaaacccgggagaaggagtatcaggagaccattgaccagatagagctggagttggccacggccaagaacgacatgaaccggcacctgcacgagtacatggagatgtgcagcatgaagcgcggcctggacgtgcagatggagacctgccgccggctcatcacccagtctggagaccgaaagtctcctgctttcactgcggtcccgcttagcgacccgccgccgccgccaagcgaggctgaggactccgatcgcgatgtctcatctgacagctccatgagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GINS complex subunit 3 (Psf3 homolog)
- GrpE-like 1, mitochondrial (E. coli)
- coiled-coil domain containing 109B
- carbonic anhydrase III, muscle specific

Buy IFFO1-intermediate filament family orphan 1 Gene now

Add to cart