Login to display prices
Login to display prices
CA3-carbonic anhydrase III, muscle specific Gene View larger

CA3-carbonic anhydrase III, muscle specific Gene

PTXBC004897

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA3-carbonic anhydrase III, muscle specific Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CA3-carbonic anhydrase III, muscle specific Gene

Proteogenix catalog: PTXBC004897
Ncbi symbol: CA3
Product name: CA3-carbonic anhydrase III, muscle specific Gene
Size: 2ug
Accessions: BC004897
Gene id: 761
Gene description: carbonic anhydrase III, muscle specific
Synonyms: CAIII; Car3; carbonic anhydrase 3; CA-III; HEL-S-167mP; carbonate dehydratase III; carbonic anhydrase III; carbonic anhydrase III, muscle specific; epididymis secretory sperm binding protein Li 167mP
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaaggagtggggctacgccagtcacaacggtcctgaccactggcatgaacttttcccaaatgccaagggggaaaaccagtcgcccattgagctgcatactaaagacatcaggcatgacccttctctgcagccatggtctgtgtcttatgatggtggctctgccaagaccatcctgaataatgggaagacctgccgagttgtatttgatgatacttatgataggtcaatgctgagagggggtcctctccctggaccctaccgacttcgccagtttcatcttcactggggctcttcggatgatcatggctctgagcacaccgtggatggagtcaagtatgcagcggagcttcatttggttcactggaacccgaagtataacacttttaaagaagccctgaagcagcgcgatgggatcgctgtgattggcatttttctgaagataggacatgagaatggcgagttccagattttccttgatgcattggacaagattaagacaaagggcaaggaggcgcccttcacaaagtttgacccatcctgcctgttcccggcatgccgggactactggacctaccagggctcattcaccacgccgccctgcgaggaatgcattgtgtggctgctgctgaaggagcccatgaccgtgagctctgaccagatggccaagctgcggagcctcctctccagtgctgagaacgagcccccagtgcctcttgtgagcaactggcgacctccacagcctatcaataacagggtggtgagagcttccttcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: