Login to display prices
Login to display prices
SF3B3-splicing factor 3b, subunit 3, 130kDa Gene View larger

SF3B3-splicing factor 3b, subunit 3, 130kDa Gene

PTXBC009780

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SF3B3-splicing factor 3b, subunit 3, 130kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SF3B3-splicing factor 3b, subunit 3, 130kDa Gene

Proteogenix catalog: PTXBC009780
Ncbi symbol: SF3B3
Product name: SF3B3-splicing factor 3b, subunit 3, 130kDa Gene
Size: 2ug
Accessions: BC009780
Gene id: 23450
Gene description: splicing factor 3b, subunit 3, 130kDa
Synonyms: RSE1; SAP130; SF3b130; STAF130; splicing factor 3B subunit 3; SAP 130; pre-mRNA splicing factor SF3b, 130 kDa subunit; spliceosome-associated protein 130
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttctgtacaacttaaccttgcagagagccactggcatcagctttgccattcatggaaacttttctggaaccaaacaacaagaaattgttgtttcccgtgggaagatcttggagctgcttcgcccagaccccaacactggcaaagtacataccctactcactgtggaagtattcggtgttatccggtcactcatggcctttaggctgacaggtggcaccaaagactacattgtagttggcagtgactctggtcgaattgttattttggaataccagccatctaagaatatgtttgagaagattcaccaagaaacctttggcaagagtggatgccgtcgcatcgttcctggccagttcttagctgtggatcccaaagggcgagccgttatgattagtgccattgagaaacagaaattggtgtatattttgaacagagatgctgcagcccgacttaccatttcatctcccctggaagcccacaaagcaaacactttagtgtatcatgtagttggagtagatgtcggatttgaaaatccaatgtttgcttgtctggaaatggattatgaggaagcagacaatgatccaacaggggaagcagcagctaatacccagcagacacttactttctatgagctagaccttggtttaaatcatgtggtccgaaaatacagtgaacctttggaggaacacggcaacttccttattacagttccaggagggtcagatggtccaagtggagtactgaacctgagtcccccattccccaaagccatccctgcattgatatgtcttgactctcctgtctacttttgcacacacccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: