Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of STAR-steroidogenic acute regulatory protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STAR-steroidogenic acute regulatory protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010550 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STAR |
| Origin species: | Human |
| Product name: | STAR-steroidogenic acute regulatory protein Gene |
| Size: | 2ug |
| Accessions: | BC010550 |
| Gene id: | 6770 |
| Gene description: | steroidogenic acute regulatory protein |
| Synonyms: | StAR related lipid transfer (START) domain containing 1; STARD1; steroidogenic acute regulatory protein, mitochondrial; START domain containing 1; START domain-containing protein 1; cholesterol trafficker; mitochondrial steroid acute regulatory protein; steroid acute regulatory protein; steroidogenic acute regulator; testis secretory sperm-binding protein Li 241mP |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctagcgacattcaagctgtgcgctgggagctcctacagacacatgcgcaacatgaaggggctgaggcaacaggctgtgatggccatcagccaggagctgaaccggagggccctggggggccccacccctagcacgtggattaaccaggttcggcggcggagctctctactcggttctcggctggaagagactctctacagtgaccaggagctggcctatctccagcagggggaggaggccatgcagaaggccttgggcatccttagcaaccaagagggctggaagaaggagagtcagcaggacaatggggacaaagtgatgagtaaagtggtcccagatgtgggcaaggtgttccggctggaggtcgtggtggaccagcccatggagaggctctatgaagagctcgtggagcgcatggaagcaatgggggagtggaaccccaatgtcaaggagatcaaggtcctgcagaagatcggaaaagatacattcattactcacgagctggctgccgaggcagcaggaaacctggtggggccccgtgactttgtgagcgtgcgctgtgccaagcgccgaggctccacctgtgtgctggctggcatggccacagacttcgggaacatgcctgagcagaagggtgtcatcagggcggagcacggtcccacttgcatggtgcttcacccgttggctggaagtccctctaagaccaaacttacgtggctactcagcatcgacctcaaggggtggctgcccaagagcatcatcaaccaggtcctgtcccagacccaggtggattttgccaaccacctgcgcaagcgcctggagtcccaccctgcctctgaagccaggtgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NmrA-like family domain containing 1 - coagulation factor XII (Hageman factor) - peroxisomal membrane protein 3, 35kDa - retinol dehydrogenase 5 (11-cis/9-cis) |