Login to display prices
Login to display prices
STAR-steroidogenic acute regulatory protein Gene View larger

STAR-steroidogenic acute regulatory protein Gene

PTXBC010550

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STAR-steroidogenic acute regulatory protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STAR-steroidogenic acute regulatory protein Gene

Proteogenix catalog: PTXBC010550
Ncbi symbol: STAR
Product name: STAR-steroidogenic acute regulatory protein Gene
Size: 2ug
Accessions: BC010550
Gene id: 6770
Gene description: steroidogenic acute regulatory protein
Synonyms: StAR related lipid transfer (START) domain containing 1; STARD1; steroidogenic acute regulatory protein, mitochondrial; START domain containing 1; START domain-containing protein 1; cholesterol trafficker; mitochondrial steroid acute regulatory protein; steroid acute regulatory protein; steroidogenic acute regulator; testis secretory sperm-binding protein Li 241mP
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctagcgacattcaagctgtgcgctgggagctcctacagacacatgcgcaacatgaaggggctgaggcaacaggctgtgatggccatcagccaggagctgaaccggagggccctggggggccccacccctagcacgtggattaaccaggttcggcggcggagctctctactcggttctcggctggaagagactctctacagtgaccaggagctggcctatctccagcagggggaggaggccatgcagaaggccttgggcatccttagcaaccaagagggctggaagaaggagagtcagcaggacaatggggacaaagtgatgagtaaagtggtcccagatgtgggcaaggtgttccggctggaggtcgtggtggaccagcccatggagaggctctatgaagagctcgtggagcgcatggaagcaatgggggagtggaaccccaatgtcaaggagatcaaggtcctgcagaagatcggaaaagatacattcattactcacgagctggctgccgaggcagcaggaaacctggtggggccccgtgactttgtgagcgtgcgctgtgccaagcgccgaggctccacctgtgtgctggctggcatggccacagacttcgggaacatgcctgagcagaagggtgtcatcagggcggagcacggtcccacttgcatggtgcttcacccgttggctggaagtccctctaagaccaaacttacgtggctactcagcatcgacctcaaggggtggctgcccaagagcatcatcaaccaggtcctgtcccagacccaggtggattttgccaaccacctgcgcaagcgcctggagtcccaccctgcctctgaagccaggtgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: