Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RDH5-retinol dehydrogenase 5 (11-cis/9-cis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RDH5-retinol dehydrogenase 5 (11-cis/9-cis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028298 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RDH5 |
| Origin species: | Human |
| Product name: | RDH5-retinol dehydrogenase 5 (11-cis/9-cis) Gene |
| Size: | 2ug |
| Accessions: | BC028298 |
| Gene id: | 5959 |
| Gene description: | retinol dehydrogenase 5 (11-cis/9-cis) |
| Synonyms: | 9cRDH; HSD17B9; RDH1; SDR9C5; 11-cis retinol dehydrogenase; 11-cis RDH; 11-cis RoDH; 9-cis retinol dehydrogenase; 9-cis-retinol specific dehydrogenase; retinol dehydrogenase 1; retinol dehydrogenase 5 (11-cis and 9-cis); retinol dehydrogenase 5 (11-cis/9-cis); short chain dehydrogenase/reductase family 9C member 5; retinol dehydrogenase 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggctgcctcttctgctgggtgccttactctgggcagtgctgtggttgctcagggaccggcagagcctgcccgccagcaatgcccttgtcttcatcaccggctgtgactcaggctttgggcgccttctggcactgcagctggaccagagaggcttccgagtcctggccagctgcctgaccccctccggggccgaggacctgcagcgggtggcctcctcccgcctccacaccaccctgttggatatcactgatccccagagcgtccagcaggcagccaagtgggtggagatgcacgttaaggaagcagggctttttggtctggtgaataatgctggtgtggctggtatcatcggacccacaccatggctgacccgggacgatttccagcgggtgctgaatgtgaacacaatgggtcccatcggggtcacccttgccctgctgcctctgctgcagcaagcccggggccgggtgatcaacatcaccagcgtcctgggtcgcctggcagccaatggtgggggctactgtgtctccaaatttggcctggaggccttctctgacagcctgaggcgggatgtagctcattttgggatacgagtctccatcgtggagcctggcttcttccgaacccctgtgaccaacctggagagtctggagaaaaccctgcaggcctgctgggcacggctgcctcctgccacacaggcccactatgggggggccttcctcaccaagtacctgaaaatgcaacagcgcatcatgaacctgatctgtgacccggacctaaccaaggtgagccgatgcctggagcatgccctgactgctcgacacccccgaacccgctacagcccaggttgggatgccaagctgctctggctgcctgcctcctacctgccagccagcctggtggatgctgtgctcacctgggtccttcccaagcctgcccaagcagtctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35, member A4 - secretory carrier membrane protein 2 - solute carrier family 35, member B4 - butyrophilin, subfamily 3, member A2 |